Incidental Mutation 'R0371:Havcr1'
ID30484
Institutional Source Beutler Lab
Gene Symbol Havcr1
Ensembl Gene ENSMUSG00000040405
Gene Namehepatitis A virus cellular receptor 1
SynonymsKIM-1, Tim1, TIM-1
MMRRC Submission 038577-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0371 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46735080-46779578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46752589 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 112 (I112T)
Ref Sequence ENSEMBL: ENSMUSP00000043827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047568] [ENSMUST00000081819] [ENSMUST00000109223] [ENSMUST00000109224]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047568
AA Change: I112T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043827
Gene: ENSMUSG00000040405
AA Change: I112T

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081819
AA Change: I112T

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080503
Gene: ENSMUSG00000040405
AA Change: I112T

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109223
AA Change: I112T

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104846
Gene: ENSMUSG00000040405
AA Change: I112T

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109224
AA Change: I112T

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104847
Gene: ENSMUSG00000040405
AA Change: I112T

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to S. mansoni egg challenge. Mice homozygous for an allele lacking the mucin domain display impaired regulatory B cell function and systemic autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,288,047 R1068C probably benign Het
Afmid C T 11: 117,835,140 probably benign Het
Aqr A G 2: 114,157,604 V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 T288R possibly damaging Het
Btnl1 T C 17: 34,381,057 V178A probably damaging Het
Ccdc110 T A 8: 45,942,806 M578K possibly damaging Het
Ccdc38 G T 10: 93,562,812 E51* probably null Het
Cep290 T A 10: 100,518,564 probably benign Het
Cilp2 T C 8: 69,881,606 E914G probably damaging Het
Col6a2 T C 10: 76,614,473 N208S probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp4a12a C G 4: 115,326,683 R229G probably damaging Het
Dach1 C T 14: 97,969,903 V337M probably damaging Het
Dcbld2 A G 16: 58,450,823 N321S probably benign Het
Enpep C T 3: 129,283,867 probably null Het
Fat1 T C 8: 44,951,892 L560P probably damaging Het
Fdxr T C 11: 115,276,089 H58R possibly damaging Het
Filip1 G T 9: 79,860,091 P147T probably damaging Het
Fras1 G A 5: 96,555,331 E318K possibly damaging Het
Gm4759 A T 7: 106,422,779 C339S unknown Het
Grk2 T C 19: 4,291,586 probably null Het
Hjurp G A 1: 88,277,368 probably benign Het
Ildr2 G A 1: 166,303,564 V330I probably damaging Het
Ino80d T C 1: 63,057,956 probably benign Het
Iqsec1 A G 6: 90,670,403 probably benign Het
Irf2bpl C T 12: 86,881,643 W752* probably null Het
Kdr T A 5: 75,941,834 H1211L probably benign Het
Klri2 A G 6: 129,732,143 *249R probably null Het
Ktn1 A T 14: 47,724,003 K1054* probably null Het
Lactb2 A G 1: 13,650,760 S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 C15* probably null Het
Mrs2 T C 13: 24,993,095 I430V probably benign Het
Myo3b C T 2: 70,252,960 probably benign Het
Nbas C T 12: 13,331,095 T696I probably damaging Het
Nsun6 T C 2: 15,030,087 D240G probably damaging Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1283 A T 2: 111,369,153 I174L probably benign Het
Olfr205 A G 16: 59,329,222 C96R possibly damaging Het
Olfr411 T A 11: 74,346,934 I217F probably damaging Het
Olfr447 A T 6: 42,911,938 R138S probably benign Het
Pabpc1l G A 2: 164,035,272 V256M probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sik1 T C 17: 31,848,984 D409G probably benign Het
Slc22a22 A T 15: 57,249,735 D369E possibly damaging Het
Smg1 T A 7: 118,168,300 probably benign Het
Snap29 C A 16: 17,406,203 D27E probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorcs3 A G 19: 48,603,894 I333V probably benign Het
Spag7 A G 11: 70,664,796 M105T probably damaging Het
Srgap3 A T 6: 112,771,471 S407T probably damaging Het
Supt6 T C 11: 78,223,157 N854S probably benign Het
Syne2 T C 12: 75,933,845 S1460P probably damaging Het
Taok3 C T 5: 117,206,687 Q160* probably null Het
Tchhl1 C A 3: 93,469,577 A27E probably damaging Het
Tet1 T C 10: 62,878,399 D539G probably damaging Het
Tut1 T C 19: 8,962,773 F374L probably damaging Het
Unc5c C T 3: 141,827,522 P770S probably benign Het
Vmn2r101 T A 17: 19,590,132 N393K probably benign Het
Vmn2r94 T A 17: 18,257,294 H285L probably benign Het
Wdr62 G A 7: 30,242,158 S700L possibly damaging Het
Wscd1 A G 11: 71,788,723 D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 N106S probably damaging Het
Zfp345 G T 2: 150,472,063 T518N possibly damaging Het
Zfp648 A T 1: 154,204,667 S191C possibly damaging Het
Zkscan8 C T 13: 21,526,674 E89K probably damaging Het
Other mutations in Havcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Havcr1 APN 11 46775493 missense probably damaging 1.00
IGL02207:Havcr1 APN 11 46778576 missense probably benign 0.28
R0355:Havcr1 UTSW 11 46756224 missense possibly damaging 0.91
R0488:Havcr1 UTSW 11 46752571 missense probably damaging 1.00
R0883:Havcr1 UTSW 11 46752432 missense probably damaging 1.00
R1307:Havcr1 UTSW 11 46756270 missense probably damaging 0.99
R1308:Havcr1 UTSW 11 46756270 missense probably damaging 0.99
R1554:Havcr1 UTSW 11 46752507 missense probably benign
R1908:Havcr1 UTSW 11 46773684 nonsense probably null
R2165:Havcr1 UTSW 11 46778552 missense probably benign 0.14
R3085:Havcr1 UTSW 11 46756225 missense probably damaging 0.99
R3757:Havcr1 UTSW 11 46752580 missense probably damaging 1.00
R4719:Havcr1 UTSW 11 46752441 missense probably benign 0.02
R5191:Havcr1 UTSW 11 46756197 missense probably benign 0.40
R5440:Havcr1 UTSW 11 46752370 missense probably damaging 1.00
R5710:Havcr1 UTSW 11 46752526 missense probably damaging 1.00
R5988:Havcr1 UTSW 11 46756137 missense probably damaging 1.00
R7570:Havcr1 UTSW 11 46770542 critical splice donor site probably null
R7962:Havcr1 UTSW 11 46752575 nonsense probably null
Z1177:Havcr1 UTSW 11 46775498 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCACAGGCGCTGTGGATTCTTATG -3'
(R):5'- AAGGTGGTCCCACGTACAGTTAGG -3'

Sequencing Primer
(F):5'- TGGGTCACCCTGTCACAC -3'
(R):5'- CCCACGTACAGTTAGGACATGG -3'
Posted On2013-04-24