Incidental Mutation 'R0371:Olfr411'
ID30487
Institutional Source Beutler Lab
Gene Symbol Olfr411
Ensembl Gene ENSMUSG00000054406
Gene Nameolfactory receptor 411
SynonymsMOR255-3, GA_x6K02T2P1NL-4481525-4480578
MMRRC Submission 038577-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0371 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74345129-74352650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74346934 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 217 (I217F)
Ref Sequence ENSEMBL: ENSMUSP00000149978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080365] [ENSMUST00000141134] [ENSMUST00000214769]
Predicted Effect probably damaging
Transcript: ENSMUST00000080365
AA Change: I217F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079235
Gene: ENSMUSG00000054406
AA Change: I217F

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 7.1e-58 PFAM
Pfam:7tm_1 44 293 8.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141134
AA Change: I97F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214769
AA Change: I217F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,288,047 R1068C probably benign Het
Afmid C T 11: 117,835,140 probably benign Het
Aqr A G 2: 114,157,604 V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 T288R possibly damaging Het
Btnl1 T C 17: 34,381,057 V178A probably damaging Het
Ccdc110 T A 8: 45,942,806 M578K possibly damaging Het
Ccdc38 G T 10: 93,562,812 E51* probably null Het
Cep290 T A 10: 100,518,564 probably benign Het
Cilp2 T C 8: 69,881,606 E914G probably damaging Het
Col6a2 T C 10: 76,614,473 N208S probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp4a12a C G 4: 115,326,683 R229G probably damaging Het
Dach1 C T 14: 97,969,903 V337M probably damaging Het
Dcbld2 A G 16: 58,450,823 N321S probably benign Het
Enpep C T 3: 129,283,867 probably null Het
Fat1 T C 8: 44,951,892 L560P probably damaging Het
Fdxr T C 11: 115,276,089 H58R possibly damaging Het
Filip1 G T 9: 79,860,091 P147T probably damaging Het
Fras1 G A 5: 96,555,331 E318K possibly damaging Het
Gm4759 A T 7: 106,422,779 C339S unknown Het
Grk2 T C 19: 4,291,586 probably null Het
Havcr1 T C 11: 46,752,589 I112T possibly damaging Het
Hjurp G A 1: 88,277,368 probably benign Het
Ildr2 G A 1: 166,303,564 V330I probably damaging Het
Ino80d T C 1: 63,057,956 probably benign Het
Iqsec1 A G 6: 90,670,403 probably benign Het
Irf2bpl C T 12: 86,881,643 W752* probably null Het
Kdr T A 5: 75,941,834 H1211L probably benign Het
Klri2 A G 6: 129,732,143 *249R probably null Het
Ktn1 A T 14: 47,724,003 K1054* probably null Het
Lactb2 A G 1: 13,650,760 S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 C15* probably null Het
Mrs2 T C 13: 24,993,095 I430V probably benign Het
Myo3b C T 2: 70,252,960 probably benign Het
Nbas C T 12: 13,331,095 T696I probably damaging Het
Nsun6 T C 2: 15,030,087 D240G probably damaging Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1283 A T 2: 111,369,153 I174L probably benign Het
Olfr205 A G 16: 59,329,222 C96R possibly damaging Het
Olfr447 A T 6: 42,911,938 R138S probably benign Het
Pabpc1l G A 2: 164,035,272 V256M probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sik1 T C 17: 31,848,984 D409G probably benign Het
Slc22a22 A T 15: 57,249,735 D369E possibly damaging Het
Smg1 T A 7: 118,168,300 probably benign Het
Snap29 C A 16: 17,406,203 D27E probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorcs3 A G 19: 48,603,894 I333V probably benign Het
Spag7 A G 11: 70,664,796 M105T probably damaging Het
Srgap3 A T 6: 112,771,471 S407T probably damaging Het
Supt6 T C 11: 78,223,157 N854S probably benign Het
Syne2 T C 12: 75,933,845 S1460P probably damaging Het
Taok3 C T 5: 117,206,687 Q160* probably null Het
Tchhl1 C A 3: 93,469,577 A27E probably damaging Het
Tet1 T C 10: 62,878,399 D539G probably damaging Het
Tut1 T C 19: 8,962,773 F374L probably damaging Het
Unc5c C T 3: 141,827,522 P770S probably benign Het
Vmn2r101 T A 17: 19,590,132 N393K probably benign Het
Vmn2r94 T A 17: 18,257,294 H285L probably benign Het
Wdr62 G A 7: 30,242,158 S700L possibly damaging Het
Wscd1 A G 11: 71,788,723 D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 N106S probably damaging Het
Zfp345 G T 2: 150,472,063 T518N possibly damaging Het
Zfp648 A T 1: 154,204,667 S191C possibly damaging Het
Zkscan8 C T 13: 21,526,674 E89K probably damaging Het
Other mutations in Olfr411
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr411 APN 11 74347429 missense probably benign 0.00
IGL01308:Olfr411 APN 11 74346660 missense probably damaging 1.00
IGL01596:Olfr411 APN 11 74347419 missense possibly damaging 0.79
IGL02233:Olfr411 APN 11 74347428 missense possibly damaging 0.51
IGL03407:Olfr411 APN 11 74347545 missense possibly damaging 0.47
R0924:Olfr411 UTSW 11 74346798 missense probably damaging 1.00
R0926:Olfr411 UTSW 11 74347306 missense probably benign 0.00
R1265:Olfr411 UTSW 11 74346940 missense probably benign 0.00
R3712:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R4446:Olfr411 UTSW 11 74346762 missense probably benign 0.12
R4669:Olfr411 UTSW 11 74346963 missense probably benign
R4851:Olfr411 UTSW 11 74346943 missense probably benign
R4990:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R4992:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R5130:Olfr411 UTSW 11 74347167 missense probably damaging 1.00
R5171:Olfr411 UTSW 11 74346814 missense probably benign 0.08
R5240:Olfr411 UTSW 11 74347242 missense probably damaging 1.00
R5346:Olfr411 UTSW 11 74346670 missense probably benign 0.00
R5491:Olfr411 UTSW 11 74346914 missense probably benign 0.07
R5723:Olfr411 UTSW 11 74347128 missense possibly damaging 0.66
R6581:Olfr411 UTSW 11 74347206 missense probably damaging 0.98
R7561:Olfr411 UTSW 11 74347610 intron probably benign
Z1177:Olfr411 UTSW 11 74347480 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGGTTCAGCATGGGACTGATGAC -3'
(R):5'- GTGCCTTCAGCAATGCACTGAC -3'

Sequencing Primer
(F):5'- AGGATGCCAATGCCCTTGTC -3'
(R):5'- ACTGACCCACACTGTGGC -3'
Posted On2013-04-24