Incidental Mutation 'R0371:Nbas'
ID30491
Institutional Source Beutler Lab
Gene Symbol Nbas
Ensembl Gene ENSMUSG00000020576
Gene Nameneuroblastoma amplified sequence
Synonyms4933425L03Rik
MMRRC Submission 038577-MU
Accession Numbers

Genbank: NM_027706.1; Ensembl: ENSMUST00000042953

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0371 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location13269133-13583811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13331095 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 696 (T696I)
Ref Sequence ENSEMBL: ENSMUSP00000036082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042953]
Predicted Effect probably damaging
Transcript: ENSMUST00000042953
AA Change: T696I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: T696I

DomainStartEndE-ValueType
Pfam:Nbas_N 89 370 4.7e-171 PFAM
low complexity region 463 475 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
Pfam:Sec39 725 1375 3.8e-34 PFAM
low complexity region 1392 1404 N/A INTRINSIC
low complexity region 1549 1566 N/A INTRINSIC
low complexity region 2226 2252 N/A INTRINSIC
low complexity region 2275 2285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221212
Meta Mutation Damage Score 0.3898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]
Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,288,047 R1068C probably benign Het
Afmid C T 11: 117,835,140 probably benign Het
Aqr A G 2: 114,157,604 V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 T288R possibly damaging Het
Btnl1 T C 17: 34,381,057 V178A probably damaging Het
Ccdc110 T A 8: 45,942,806 M578K possibly damaging Het
Ccdc38 G T 10: 93,562,812 E51* probably null Het
Cep290 T A 10: 100,518,564 probably benign Het
Cilp2 T C 8: 69,881,606 E914G probably damaging Het
Col6a2 T C 10: 76,614,473 N208S probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp4a12a C G 4: 115,326,683 R229G probably damaging Het
Dach1 C T 14: 97,969,903 V337M probably damaging Het
Dcbld2 A G 16: 58,450,823 N321S probably benign Het
Enpep C T 3: 129,283,867 probably null Het
Fat1 T C 8: 44,951,892 L560P probably damaging Het
Fdxr T C 11: 115,276,089 H58R possibly damaging Het
Filip1 G T 9: 79,860,091 P147T probably damaging Het
Fras1 G A 5: 96,555,331 E318K possibly damaging Het
Gm4759 A T 7: 106,422,779 C339S unknown Het
Grk2 T C 19: 4,291,586 probably null Het
Havcr1 T C 11: 46,752,589 I112T possibly damaging Het
Hjurp G A 1: 88,277,368 probably benign Het
Ildr2 G A 1: 166,303,564 V330I probably damaging Het
Ino80d T C 1: 63,057,956 probably benign Het
Iqsec1 A G 6: 90,670,403 probably benign Het
Irf2bpl C T 12: 86,881,643 W752* probably null Het
Kdr T A 5: 75,941,834 H1211L probably benign Het
Klri2 A G 6: 129,732,143 *249R probably null Het
Ktn1 A T 14: 47,724,003 K1054* probably null Het
Lactb2 A G 1: 13,650,760 S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 C15* probably null Het
Mrs2 T C 13: 24,993,095 I430V probably benign Het
Myo3b C T 2: 70,252,960 probably benign Het
Nsun6 T C 2: 15,030,087 D240G probably damaging Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1283 A T 2: 111,369,153 I174L probably benign Het
Olfr205 A G 16: 59,329,222 C96R possibly damaging Het
Olfr411 T A 11: 74,346,934 I217F probably damaging Het
Olfr447 A T 6: 42,911,938 R138S probably benign Het
Pabpc1l G A 2: 164,035,272 V256M probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sik1 T C 17: 31,848,984 D409G probably benign Het
Slc22a22 A T 15: 57,249,735 D369E possibly damaging Het
Smg1 T A 7: 118,168,300 probably benign Het
Snap29 C A 16: 17,406,203 D27E probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorcs3 A G 19: 48,603,894 I333V probably benign Het
Spag7 A G 11: 70,664,796 M105T probably damaging Het
Srgap3 A T 6: 112,771,471 S407T probably damaging Het
Supt6 T C 11: 78,223,157 N854S probably benign Het
Syne2 T C 12: 75,933,845 S1460P probably damaging Het
Taok3 C T 5: 117,206,687 Q160* probably null Het
Tchhl1 C A 3: 93,469,577 A27E probably damaging Het
Tet1 T C 10: 62,878,399 D539G probably damaging Het
Tut1 T C 19: 8,962,773 F374L probably damaging Het
Unc5c C T 3: 141,827,522 P770S probably benign Het
Vmn2r101 T A 17: 19,590,132 N393K probably benign Het
Vmn2r94 T A 17: 18,257,294 H285L probably benign Het
Wdr62 G A 7: 30,242,158 S700L possibly damaging Het
Wscd1 A G 11: 71,788,723 D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 N106S probably damaging Het
Zfp345 G T 2: 150,472,063 T518N possibly damaging Het
Zfp648 A T 1: 154,204,667 S191C possibly damaging Het
Zkscan8 C T 13: 21,526,674 E89K probably damaging Het
Other mutations in Nbas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Nbas APN 12 13453075 missense probably benign 0.19
IGL00712:Nbas APN 12 13362625 splice site probably benign
IGL00808:Nbas APN 12 13566120 splice site probably benign
IGL00915:Nbas APN 12 13374752 nonsense probably null
IGL00923:Nbas APN 12 13336284 missense possibly damaging 0.46
IGL01152:Nbas APN 12 13360958 missense probably damaging 1.00
IGL01633:Nbas APN 12 13483897 missense probably damaging 1.00
IGL01672:Nbas APN 12 13379649 missense possibly damaging 0.63
IGL01799:Nbas APN 12 13324400 splice site probably benign
IGL01812:Nbas APN 12 13453503 missense probably damaging 1.00
IGL01934:Nbas APN 12 13289879 splice site probably benign
IGL02093:Nbas APN 12 13560962 missense probably benign 0.00
IGL02115:Nbas APN 12 13317692 splice site probably benign
IGL02175:Nbas APN 12 13566259 critical splice donor site probably null
IGL02268:Nbas APN 12 13405397 missense possibly damaging 0.94
IGL02483:Nbas APN 12 13324294 missense probably damaging 1.00
IGL02539:Nbas APN 12 13272703 splice site probably benign
IGL02557:Nbas APN 12 13361028 missense probably damaging 1.00
IGL02815:Nbas APN 12 13310266 missense probably damaging 1.00
IGL02951:Nbas APN 12 13362541 missense probably benign
IGL03131:Nbas APN 12 13279416 missense probably benign 0.03
IGL03214:Nbas APN 12 13331110 splice site probably benign
IGL03308:Nbas APN 12 13324348 missense possibly damaging 0.93
IGL03368:Nbas APN 12 13328451 missense probably benign 0.08
IGL03372:Nbas APN 12 13534472 missense probably damaging 1.00
IGL03391:Nbas APN 12 13483749 missense probably benign 0.28
medvedev UTSW 12 13534577 critical splice donor site probably null
oligarchs UTSW 12 13520750 missense possibly damaging 0.75
putin UTSW 12 13321755 missense probably damaging 1.00
1mM(1):Nbas UTSW 12 13288728 missense probably damaging 1.00
R0057:Nbas UTSW 12 13390957 missense probably benign 0.00
R0076:Nbas UTSW 12 13324336 missense probably damaging 1.00
R0153:Nbas UTSW 12 13273876 splice site probably benign
R0449:Nbas UTSW 12 13519108 missense probably benign 0.18
R0791:Nbas UTSW 12 13482633 missense probably benign 0.28
R0931:Nbas UTSW 12 13331114 splice site probably benign
R1236:Nbas UTSW 12 13269241 missense probably damaging 1.00
R1371:Nbas UTSW 12 13482378 splice site probably benign
R1567:Nbas UTSW 12 13285278 missense possibly damaging 0.70
R1587:Nbas UTSW 12 13558685 missense probably benign
R1719:Nbas UTSW 12 13560977 critical splice donor site probably null
R1747:Nbas UTSW 12 13335898 missense probably benign 0.00
R1777:Nbas UTSW 12 13513562 missense probably benign 0.16
R1848:Nbas UTSW 12 13413597 missense probably damaging 0.97
R1856:Nbas UTSW 12 13474229 missense possibly damaging 0.56
R1891:Nbas UTSW 12 13390972 missense possibly damaging 0.92
R1911:Nbas UTSW 12 13566144 missense probably benign
R1912:Nbas UTSW 12 13566144 missense probably benign
R2006:Nbas UTSW 12 13414741 intron probably null
R2054:Nbas UTSW 12 13474206 missense probably benign 0.36
R2065:Nbas UTSW 12 13566157 missense probably damaging 1.00
R2089:Nbas UTSW 12 13361045 missense probably benign 0.03
R2091:Nbas UTSW 12 13361045 missense probably benign 0.03
R2091:Nbas UTSW 12 13361045 missense probably benign 0.03
R2156:Nbas UTSW 12 13441509 missense probably damaging 1.00
R2164:Nbas UTSW 12 13330646 missense possibly damaging 0.74
R2339:Nbas UTSW 12 13362592 missense probably benign 0.12
R2398:Nbas UTSW 12 13432945 missense probably damaging 0.99
R3806:Nbas UTSW 12 13482504 missense probably damaging 1.00
R3855:Nbas UTSW 12 13279414 missense possibly damaging 0.50
R4019:Nbas UTSW 12 13482519 missense probably damaging 1.00
R4083:Nbas UTSW 12 13474191 missense probably damaging 0.96
R4201:Nbas UTSW 12 13374826 missense probably benign 0.00
R4231:Nbas UTSW 12 13393343 missense probably damaging 0.98
R4552:Nbas UTSW 12 13335937 critical splice donor site probably null
R4560:Nbas UTSW 12 13583527 missense probably benign 0.00
R4728:Nbas UTSW 12 13288739 missense probably damaging 0.98
R4752:Nbas UTSW 12 13482537 missense possibly damaging 0.92
R4832:Nbas UTSW 12 13483739 missense probably benign 0.00
R4874:Nbas UTSW 12 13321755 missense probably damaging 1.00
R4988:Nbas UTSW 12 13408265 missense probably benign 0.45
R5020:Nbas UTSW 12 13374712 missense probably damaging 0.99
R5079:Nbas UTSW 12 13374711 missense probably damaging 1.00
R5129:Nbas UTSW 12 13390960 missense probably damaging 1.00
R5239:Nbas UTSW 12 13441518 missense probably benign 0.31
R5299:Nbas UTSW 12 13441925 nonsense probably null
R5351:Nbas UTSW 12 13560849 missense probably damaging 1.00
R5389:Nbas UTSW 12 13534577 critical splice donor site probably null
R5436:Nbas UTSW 12 13374811 missense probably damaging 1.00
R5654:Nbas UTSW 12 13583475 missense probably damaging 1.00
R5690:Nbas UTSW 12 13336284 missense probably damaging 1.00
R5842:Nbas UTSW 12 13269266 critical splice donor site probably null
R5959:Nbas UTSW 12 13288801 missense probably damaging 0.99
R5982:Nbas UTSW 12 13393430 missense probably benign 0.00
R6238:Nbas UTSW 12 13482595 missense probably benign
R6270:Nbas UTSW 12 13324293 missense probably damaging 1.00
R6363:Nbas UTSW 12 13482576 missense probably benign
R6424:Nbas UTSW 12 13415733 critical splice donor site probably null
R6458:Nbas UTSW 12 13288749 missense probably damaging 1.00
R6526:Nbas UTSW 12 13405425 missense probably damaging 1.00
R6654:Nbas UTSW 12 13483874 nonsense probably null
R7085:Nbas UTSW 12 13285258 missense probably damaging 1.00
R7179:Nbas UTSW 12 13405397 missense possibly damaging 0.94
R7197:Nbas UTSW 12 13520750 missense possibly damaging 0.75
R7378:Nbas UTSW 12 13274219 missense probably damaging 1.00
R7393:Nbas UTSW 12 13393492 missense probably damaging 1.00
R7425:Nbas UTSW 12 13469880 missense probably damaging 1.00
R7446:Nbas UTSW 12 13393498 missense probably benign 0.02
R7481:Nbas UTSW 12 13356959 missense probably damaging 0.97
R7535:Nbas UTSW 12 13279389 missense probably damaging 0.97
R7626:Nbas UTSW 12 13558660 missense probably benign 0.00
R7678:Nbas UTSW 12 13415661 missense probably damaging 0.97
R7912:Nbas UTSW 12 13405457 missense possibly damaging 0.91
R7993:Nbas UTSW 12 13405457 missense possibly damaging 0.91
RF013:Nbas UTSW 12 13279408 missense possibly damaging 0.54
T0722:Nbas UTSW 12 13352808 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCTTTTGCCTCAGACAGACAG -3'
(R):5'- AATCAACACAGTTCCTCTGCCTCG -3'

Sequencing Primer
(F):5'- CAAAAGGAACTGTGCCGTTG -3'
(R):5'- tcctctgcctcggcttc -3'
Posted On2013-04-24