Mutagenetix > Incidental Mutations

Incidental Mutation 'R0371:Lrrc3b'

30494

Institutional Source

Beutler Lab

Gene Symbol

Lrrc3b

Ensembl Gene

ENSMUSG00000045201

Gene Name

leucine rich repeat containing 3B

Synonyms

LRP15

MMRRC Submission

038577-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0371 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15357515-15438987 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 15358560 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 15 (C15*)

Ref Sequence

ENSEMBL: ENSMUSP00000153616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055211] [ENSMUST00000163937] [ENSMUST00000223700]

Predicted Effect

probably null
Transcript: ENSMUST00000055211
AA Change: C15*

SMART Domains

Protein: ENSMUSP00000059463
Gene: ENSMUSG00000045201
AA Change: C15*

Domain	Start	End	E-Value	Type
LRRNT	33	68	1.85e-8	SMART
LRR	67	86	3e1	SMART
LRR_TYP	87	110	8.94e-3	SMART
LRR	115	135	3.86e0	SMART
Blast:LRRCT	145	196	2e-8	BLAST
transmembrane domain	203	225	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000163937
AA Change: C15*

SMART Domains

Protein: ENSMUSP00000128624
Gene: ENSMUSG00000045201
AA Change: C15*

Domain	Start	End	E-Value	Type
LRRNT	33	68	1.85e-8	SMART
LRR	67	86	3e1	SMART
LRR_TYP	87	110	8.94e-3	SMART
LRR	115	135	3.86e0	SMART
Blast:LRRCT	145	196	2e-8	BLAST
transmembrane domain	203	225	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000223700
AA Change: C15*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.6%
20x: 90.6%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor suppressor, with lowered expression levels found in gastric, renal, colorectal, lung, and breast cancer tissues. The promoter of this gene is frequently hypermethylated in these cancer tissues, although the hypermethylation does not appear to be the cause of the reduced expression of this gene. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal olfactory epithelium and bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	G	A	16: 4,288,047	R1068C	probably benign	Het
Afmid	C	T	11: 117,835,140		probably benign	Het
Aqr	A	G	2: 114,157,604	V159A	possibly damaging	Het
Atp6v0d2	G	C	4: 19,880,033	T288R	possibly damaging	Het
Btnl1	T	C	17: 34,381,057	V178A	probably damaging	Het
Ccdc110	T	A	8: 45,942,806	M578K	possibly damaging	Het
Ccdc38	G	T	10: 93,562,812	E51*	probably null	Het
Cep290	T	A	10: 100,518,564		probably benign	Het
Cilp2	T	C	8: 69,881,606	E914G	probably damaging	Het
Col6a2	T	C	10: 76,614,473	N208S	probably benign	Het
Ctrb1	T	A	8: 111,687,151	I194F	probably benign	Het
Cyp4a12a	C	G	4: 115,326,683	R229G	probably damaging	Het
Dach1	C	T	14: 97,969,903	V337M	probably damaging	Het
Dcbld2	A	G	16: 58,450,823	N321S	probably benign	Het
Enpep	C	T	3: 129,283,867		probably null	Het
Fat1	T	C	8: 44,951,892	L560P	probably damaging	Het
Fdxr	T	C	11: 115,276,089	H58R	possibly damaging	Het
Filip1	G	T	9: 79,860,091	P147T	probably damaging	Het
Fras1	G	A	5: 96,555,331	E318K	possibly damaging	Het
Gm4759	A	T	7: 106,422,779	C339S	unknown	Het
Grk2	T	C	19: 4,291,586		probably null	Het
Havcr1	T	C	11: 46,752,589	I112T	possibly damaging	Het
Hjurp	G	A	1: 88,277,368		probably benign	Het
Ildr2	G	A	1: 166,303,564	V330I	probably damaging	Het
Ino80d	T	C	1: 63,057,956		probably benign	Het
Iqsec1	A	G	6: 90,670,403		probably benign	Het
Irf2bpl	C	T	12: 86,881,643	W752*	probably null	Het
Kdr	T	A	5: 75,941,834	H1211L	probably benign	Het
Klri2	A	G	6: 129,732,143	*249R	probably null	Het
Ktn1	A	T	14: 47,724,003	K1054*	probably null	Het
Lactb2	A	G	1: 13,650,760	S83P	possibly damaging	Het
Mrs2	T	C	13: 24,993,095	I430V	probably benign	Het
Myo3b	C	T	2: 70,252,960		probably benign	Het
Nbas	C	T	12: 13,331,095	T696I	probably damaging	Het
Nsun6	T	C	2: 15,030,087	D240G	probably damaging	Het
Nup107	T	C	10: 117,763,769	E615G	probably damaging	Het
Olfr1283	A	T	2: 111,369,153	I174L	probably benign	Het
Olfr205	A	G	16: 59,329,222	C96R	possibly damaging	Het
Olfr411	T	A	11: 74,346,934	I217F	probably damaging	Het
Olfr447	A	T	6: 42,911,938	R138S	probably benign	Het
Pabpc1l	G	A	2: 164,035,272	V256M	probably benign	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Sik1	T	C	17: 31,848,984	D409G	probably benign	Het
Slc22a22	A	T	15: 57,249,735	D369E	possibly damaging	Het
Smg1	T	A	7: 118,168,300		probably benign	Het
Snap29	C	A	16: 17,406,203	D27E	probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Sorcs3	A	G	19: 48,603,894	I333V	probably benign	Het
Spag7	A	G	11: 70,664,796	M105T	probably damaging	Het
Srgap3	A	T	6: 112,771,471	S407T	probably damaging	Het
Supt6	T	C	11: 78,223,157	N854S	probably benign	Het
Syne2	T	C	12: 75,933,845	S1460P	probably damaging	Het
Taok3	C	T	5: 117,206,687	Q160*	probably null	Het
Tchhl1	C	A	3: 93,469,577	A27E	probably damaging	Het
Tet1	T	C	10: 62,878,399	D539G	probably damaging	Het
Tut1	T	C	19: 8,962,773	F374L	probably damaging	Het
Unc5c	C	T	3: 141,827,522	P770S	probably benign	Het
Vmn2r101	T	A	17: 19,590,132	N393K	probably benign	Het
Vmn2r94	T	A	17: 18,257,294	H285L	probably benign	Het
Wdr62	G	A	7: 30,242,158	S700L	possibly damaging	Het
Wscd1	A	G	11: 71,788,723	D474G	probably damaging	Het
Zcchc7	A	G	4: 44,762,190	N106S	probably damaging	Het
Zfp345	G	T	2: 150,472,063	T518N	possibly damaging	Het
Zfp648	A	T	1: 154,204,667	S191C	possibly damaging	Het
Zkscan8	C	T	13: 21,526,674	E89K	probably damaging	Het

Other mutations in Lrrc3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01761:Lrrc3b	APN	14	15358098	missense	probably benign	0.00
IGL03141:Lrrc3b	APN	14	15358390	missense	probably damaging	1.00
Klutz	UTSW	14	15357946	missense	probably damaging	1.00
PIT4810001:Lrrc3b	UTSW	14	15358273	missense	probably benign	0.17
R1750:Lrrc3b	UTSW	14	15358601	missense	probably benign	0.00
R2280:Lrrc3b	UTSW	14	15358076	missense	probably damaging	0.99
R4663:Lrrc3b	UTSW	14	15358220	missense	probably benign	0.01
R4929:Lrrc3b	UTSW	14	15357888	missense	probably damaging	1.00
R5344:Lrrc3b	UTSW	14	15358591	missense	probably damaging	1.00
R6537:Lrrc3b	UTSW	14	15357946	missense	probably damaging	1.00
R7301:Lrrc3b	UTSW	14	15357934	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCGTCAATAAACTCGATGCCG -3'
(R):5'- TTTGAACCACCCAGGAAGGAAATCC -3'

Sequencing Primer
(F):5'- TGGACAGGTTAAGCACTCTC -3'
(R):5'- ATCCAGAGTGTGGTCAGGG -3'

Posted On

2013-04-24