Incidental Mutation 'R0371:Btnl1'
ID 30503
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Name butyrophilin-like 1
Synonyms LOC240074, Btnl3, NG10, LOC240074
MMRRC Submission 038577-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0371 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34596106-34605002 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34600031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 178 (V178A)
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
AlphaFold Q7TST0
Predicted Effect probably damaging
Transcript: ENSMUST00000080254
AA Change: V178A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: V178A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Meta Mutation Damage Score 0.2000 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,105,911 (GRCm39) R1068C probably benign Het
Afmid C T 11: 117,725,966 (GRCm39) probably benign Het
Aqr A G 2: 113,988,085 (GRCm39) V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 (GRCm39) T288R possibly damaging Het
Ccdc110 T A 8: 46,395,843 (GRCm39) M578K possibly damaging Het
Ccdc38 G T 10: 93,398,674 (GRCm39) E51* probably null Het
Cep290 T A 10: 100,354,426 (GRCm39) probably benign Het
Cilp2 T C 8: 70,334,256 (GRCm39) E914G probably damaging Het
Col6a2 T C 10: 76,450,307 (GRCm39) N208S probably benign Het
Ctrb1 T A 8: 112,413,783 (GRCm39) I194F probably benign Het
Cyp4a12a C G 4: 115,183,880 (GRCm39) R229G probably damaging Het
Dach1 C T 14: 98,207,339 (GRCm39) V337M probably damaging Het
Dcbld2 A G 16: 58,271,186 (GRCm39) N321S probably benign Het
Enpep C T 3: 129,077,516 (GRCm39) probably null Het
Fat1 T C 8: 45,404,929 (GRCm39) L560P probably damaging Het
Fdxr T C 11: 115,166,915 (GRCm39) H58R possibly damaging Het
Filip1 G T 9: 79,767,373 (GRCm39) P147T probably damaging Het
Fras1 G A 5: 96,703,190 (GRCm39) E318K possibly damaging Het
Grk2 T C 19: 4,341,614 (GRCm39) probably null Het
Gvin-ps6 A T 7: 106,021,986 (GRCm39) C339S unknown Het
Havcr1 T C 11: 46,643,416 (GRCm39) I112T possibly damaging Het
Hjurp G A 1: 88,205,090 (GRCm39) probably benign Het
Ildr2 G A 1: 166,131,133 (GRCm39) V330I probably damaging Het
Ino80d T C 1: 63,097,115 (GRCm39) probably benign Het
Iqsec1 A G 6: 90,647,385 (GRCm39) probably benign Het
Irf2bpl C T 12: 86,928,417 (GRCm39) W752* probably null Het
Kdr T A 5: 76,102,494 (GRCm39) H1211L probably benign Het
Klri2 A G 6: 129,709,106 (GRCm39) *249R probably null Het
Ktn1 A T 14: 47,961,460 (GRCm39) K1054* probably null Het
Lactb2 A G 1: 13,720,984 (GRCm39) S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 (GRCm38) C15* probably null Het
Mrs2 T C 13: 25,177,078 (GRCm39) I430V probably benign Het
Myo3b C T 2: 70,083,304 (GRCm39) probably benign Het
Nbas C T 12: 13,381,096 (GRCm39) T696I probably damaging Het
Nsun6 T C 2: 15,034,898 (GRCm39) D240G probably damaging Het
Nup107 T C 10: 117,599,674 (GRCm39) E615G probably damaging Het
Or2a25 A T 6: 42,888,872 (GRCm39) R138S probably benign Het
Or3a1d T A 11: 74,237,760 (GRCm39) I217F probably damaging Het
Or4k77 A T 2: 111,199,498 (GRCm39) I174L probably benign Het
Or5ac23 A G 16: 59,149,585 (GRCm39) C96R possibly damaging Het
Pabpc1l G A 2: 163,877,192 (GRCm39) V256M probably benign Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Sik1 T C 17: 32,067,958 (GRCm39) D409G probably benign Het
Slc22a22 A T 15: 57,113,131 (GRCm39) D369E possibly damaging Het
Smg1 T A 7: 117,767,523 (GRCm39) probably benign Het
Snap29 C A 16: 17,224,067 (GRCm39) D27E probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Sorcs3 A G 19: 48,592,333 (GRCm39) I333V probably benign Het
Spag7 A G 11: 70,555,622 (GRCm39) M105T probably damaging Het
Srgap3 A T 6: 112,748,432 (GRCm39) S407T probably damaging Het
Supt6 T C 11: 78,113,983 (GRCm39) N854S probably benign Het
Syne2 T C 12: 75,980,619 (GRCm39) S1460P probably damaging Het
Taok3 C T 5: 117,344,752 (GRCm39) Q160* probably null Het
Tchhl1 C A 3: 93,376,884 (GRCm39) A27E probably damaging Het
Tet1 T C 10: 62,714,178 (GRCm39) D539G probably damaging Het
Tut1 T C 19: 8,940,137 (GRCm39) F374L probably damaging Het
Unc5c C T 3: 141,533,283 (GRCm39) P770S probably benign Het
Vmn2r101 T A 17: 19,810,394 (GRCm39) N393K probably benign Het
Vmn2r94 T A 17: 18,477,556 (GRCm39) H285L probably benign Het
Wdr62 G A 7: 29,941,583 (GRCm39) S700L possibly damaging Het
Wscd1 A G 11: 71,679,549 (GRCm39) D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 (GRCm39) N106S probably damaging Het
Zfp345 G T 2: 150,313,983 (GRCm39) T518N possibly damaging Het
Zfp648 A T 1: 154,080,413 (GRCm39) S191C possibly damaging Het
Zkscan8 C T 13: 21,710,844 (GRCm39) E89K probably damaging Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34,600,091 (GRCm39) missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34,604,659 (GRCm39) missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34,598,509 (GRCm39) missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34,601,239 (GRCm39) missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34,604,486 (GRCm39) missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34,600,030 (GRCm39) missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R1689:Btnl1 UTSW 17 34,600,182 (GRCm39) nonsense probably null
R1982:Btnl1 UTSW 17 34,598,725 (GRCm39) missense possibly damaging 0.81
R2109:Btnl1 UTSW 17 34,598,578 (GRCm39) missense probably damaging 1.00
R2134:Btnl1 UTSW 17 34,604,608 (GRCm39) missense possibly damaging 0.48
R2760:Btnl1 UTSW 17 34,600,012 (GRCm39) missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34,600,133 (GRCm39) missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34,601,436 (GRCm39) missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34,598,699 (GRCm39) missense probably damaging 0.99
R4625:Btnl1 UTSW 17 34,598,725 (GRCm39) missense probably null 0.99
R5579:Btnl1 UTSW 17 34,600,526 (GRCm39) critical splice donor site probably null
R5811:Btnl1 UTSW 17 34,604,503 (GRCm39) missense probably damaging 1.00
R6380:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R6602:Btnl1 UTSW 17 34,604,722 (GRCm39) missense probably damaging 0.99
R6633:Btnl1 UTSW 17 34,604,305 (GRCm39) missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34,604,647 (GRCm39) missense possibly damaging 0.86
R8136:Btnl1 UTSW 17 34,599,014 (GRCm39) splice site probably null
R8840:Btnl1 UTSW 17 34,604,577 (GRCm39) missense probably benign 0.17
R9120:Btnl1 UTSW 17 34,598,681 (GRCm39) missense possibly damaging 0.85
R9515:Btnl1 UTSW 17 34,600,118 (GRCm39) missense probably benign 0.00
R9528:Btnl1 UTSW 17 34,603,352 (GRCm39) missense possibly damaging 0.91
R9577:Btnl1 UTSW 17 34,603,335 (GRCm39) missense probably benign 0.16
RF041:Btnl1 UTSW 17 34,600,342 (GRCm39) missense probably benign 0.04
X0026:Btnl1 UTSW 17 34,596,906 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTGACACCCTCTGGCACTAAC -3'
(R):5'- TGGGATTTTGGATGGAGCAGATCAC -3'

Sequencing Primer
(F):5'- CTGAGGTCAAGCAGTGTCAC -3'
(R):5'- TGGAGCAGATCACATTGCC -3'
Posted On 2013-04-24