Mutagenetix > Incidental Mutations

Incidental Mutation 'R0372:Rnf20'

30520

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

MMRRC Submission

038578-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0372 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 49650176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 582 (R582G)

Ref Sequence

ENSEMBL: ENSMUSP00000128546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029989
AA Change: R582G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: R582G

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131962

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138490

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149862

Predicted Effect

unknown
Transcript: ENSMUST00000156314
AA Change: R582G

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: R582G

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167496
AA Change: R582G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: R582G

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Meta Mutation Damage Score

0.0576

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.2%
20x: 88.6%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	T	A	14: 63,973,482	Q99L	probably damaging	Het
Abca2	A	G	2: 25,437,353	Y641C	probably damaging	Het
Abhd10	A	G	16: 45,736,891		probably null	Het
Acan	G	T	7: 79,100,601	A1707S	probably benign	Het
Ankrd61	T	A	5: 143,891,175	R284S	probably benign	Het
Ap3d1	T	C	10: 80,723,567	K258E	probably damaging	Het
Arl6ip6	T	G	2: 53,202,921	F153V	probably damaging	Het
Atp2c2	C	A	8: 119,757,441	F930L	probably benign	Het
Avl9	T	C	6: 56,726,324		probably null	Het
Axin2	A	G	11: 108,923,333	S16G	probably damaging	Het
Axin2	T	A	11: 108,924,110		probably benign	Het
Bbs7	A	T	3: 36,602,832	D282E	probably benign	Het
Ccny	A	T	18: 9,345,201	V191D	probably damaging	Het
Cdk11b	A	G	4: 155,641,500		probably benign	Het
Chd1	T	A	17: 17,387,290	C367S	probably benign	Het
Cnnm4	G	A	1: 36,498,010	V472M	probably damaging	Het
Cpb2	T	A	14: 75,242,377	I8N	probably benign	Het
Dusp11	A	G	6: 85,958,730		probably benign	Het
Elmo1	T	C	13: 20,572,459		probably null	Het
Gbf1	C	T	19: 46,285,704	P1726S	probably benign	Het
Hal	A	G	10: 93,507,553		probably benign	Het
Hlcs	T	C	16: 94,138,907	I671V	possibly damaging	Het
Ifnab	A	G	4: 88,690,834	S132P	probably benign	Het
Ing5	T	C	1: 93,812,420	I70T	probably damaging	Het
Ints1	T	C	5: 139,772,438	N228S	probably damaging	Het
Itgb6	T	A	2: 60,627,841	I523F	probably benign	Het
Kat2b	T	C	17: 53,638,537	F328S	possibly damaging	Het
Kbtbd3	A	T	9: 4,316,950	I34F	possibly damaging	Het
Klhl11	A	T	11: 100,463,522	I491N	probably damaging	Het
Lmo7	A	T	14: 101,918,053		probably benign	Het
Lrp1	G	T	10: 127,592,136	P523T	probably damaging	Het
Lrp1b	T	A	2: 40,730,798	D3556V	probably benign	Het
Lrp2	T	A	2: 69,535,043	H262L	probably benign	Het
Lrrc27	T	A	7: 139,226,187	I256K	probably benign	Het
Lrrc47	G	A	4: 154,019,632	R523K	probably benign	Het
Lrrc71	A	T	3: 87,745,777	S111T	probably benign	Het
Map3k7cl	T	C	16: 87,581,212	V72A	probably damaging	Het
Mphosph10	G	T	7: 64,388,855		probably benign	Het
Nlrp4a	T	C	7: 26,449,232		probably benign	Het
Nsd2	A	T	5: 33,891,551	M1140L	probably damaging	Het
Nt5dc3	T	C	10: 86,825,291	M440T	possibly damaging	Het
Olfr183	T	C	16: 59,000,087	V134A	probably benign	Het
Oog4	A	T	4: 143,437,689	L424Q	probably damaging	Het
Orc5	A	T	5: 22,533,784	Y160N	possibly damaging	Het
Papola	T	C	12: 105,818,838	F410L	probably benign	Het
Pcdh10	A	G	3: 45,379,497	E82G	probably damaging	Het
Pcdh20	T	C	14: 88,469,003	Y287C	probably damaging	Het
Pld1	T	A	3: 28,088,638		probably null	Het
Plekha8	G	A	6: 54,616,758		probably null	Het
Ppbp	C	T	5: 90,769,343	T93M	possibly damaging	Het
Prpsap2	A	G	11: 61,741,000	I177T	possibly damaging	Het
Rab3gap2	C	T	1: 185,262,694	T810M	possibly damaging	Het
Rassf9	A	G	10: 102,546,011	N418S	possibly damaging	Het
Serpine2	T	C	1: 79,821,430	I36V	probably damaging	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Slc24a2	A	T	4: 87,227,292	V175E	probably damaging	Het
Sned1	T	C	1: 93,285,951		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spg11	GCC	G	2: 122,059,447		probably null	Het
Tecrl	C	T	5: 83,294,659	C189Y	probably damaging	Het
Tert	A	G	13: 73,648,991	D1116G	probably damaging	Het
Thnsl2	T	C	6: 71,139,790	Y126C	probably damaging	Het
Tll2	T	C	19: 41,183,313		probably null	Het
Ubqln4	C	T	3: 88,555,969	S147L	probably benign	Het
Ugt2b5	A	T	5: 87,140,258	C17S	probably benign	Het
Vps41	A	T	13: 18,842,247	Q505L	probably benign	Het
Zfp386	T	C	12: 116,054,816	M35T	possibly damaging	Het
Zfp777	T	C	6: 48,044,476	M71V	possibly damaging	Het
Zfp938	A	T	10: 82,227,828	L34Q	probably damaging	Het
Zfp974	A	T	7: 27,920,695		probably null	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0486:Rnf20	UTSW	4	49645907	missense	possibly damaging	0.57
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R0927:Rnf20	UTSW	4	49642176	missense	probably damaging	1.00
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1460:Rnf20	UTSW	4	49645873	splice site	probably benign
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R2915:Rnf20	UTSW	4	49638769	missense	probably benign	0.13
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R4960:Rnf20	UTSW	4	49638029	missense	probably damaging	0.99
R5022:Rnf20	UTSW	4	49642016	intron	probably benign
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5379:Rnf20	UTSW	4	49652639	missense	possibly damaging	0.47
R5423:Rnf20	UTSW	4	49644620	missense	probably damaging	0.99
R6297:Rnf20	UTSW	4	49642132	missense	probably damaging	1.00
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7064:Rnf20	UTSW	4	49644580	nonsense	probably null
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
R8995:Rnf20	UTSW	4	49648437	missense	possibly damaging	0.94
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGACCTGAACAAGGTGACCTGGAG -3'
(R):5'- TGCTTGGGTGAGCCATACCATAAAG -3'

Sequencing Primer
(F):5'- AAGCATCTTGCTCCATAGAGGTC -3'
(R):5'- TAGGTCCAGGCTCTGAATCC -3'

Posted On

2013-04-24