Incidental Mutation 'R0372:Dusp11'
ID30538
Institutional Source Beutler Lab
Gene Symbol Dusp11
Ensembl Gene ENSMUSG00000030002
Gene Namedual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Synonyms
MMRRC Submission 038578-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0372 (G1)
Quality Score220
Status Validated
Chromosome6
Chromosomal Location85942268-85961667 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 85958730 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032071]
Predicted Effect probably benign
Transcript: ENSMUST00000032071
SMART Domains Protein: ENSMUSP00000032071
Gene: ENSMUSG00000030002

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
Pfam:DSPc 74 203 2.5e-18 PFAM
low complexity region 230 243 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156821
Predicted Effect probably benign
Transcript: ENSMUST00000201530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202379
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is localized to the nucleus and binds directly to RNA and splicing factors, and thus it is suggested to participate in nuclear mRNA metabolism. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik T A 14: 63,973,482 Q99L probably damaging Het
Abca2 A G 2: 25,437,353 Y641C probably damaging Het
Abhd10 A G 16: 45,736,891 probably null Het
Acan G T 7: 79,100,601 A1707S probably benign Het
Ankrd61 T A 5: 143,891,175 R284S probably benign Het
Ap3d1 T C 10: 80,723,567 K258E probably damaging Het
Arl6ip6 T G 2: 53,202,921 F153V probably damaging Het
Atp2c2 C A 8: 119,757,441 F930L probably benign Het
Avl9 T C 6: 56,726,324 probably null Het
Axin2 A G 11: 108,923,333 S16G probably damaging Het
Axin2 T A 11: 108,924,110 probably benign Het
Bbs7 A T 3: 36,602,832 D282E probably benign Het
Ccny A T 18: 9,345,201 V191D probably damaging Het
Cdk11b A G 4: 155,641,500 probably benign Het
Chd1 T A 17: 17,387,290 C367S probably benign Het
Cnnm4 G A 1: 36,498,010 V472M probably damaging Het
Cpb2 T A 14: 75,242,377 I8N probably benign Het
Elmo1 T C 13: 20,572,459 probably null Het
Gbf1 C T 19: 46,285,704 P1726S probably benign Het
Hal A G 10: 93,507,553 probably benign Het
Hlcs T C 16: 94,138,907 I671V possibly damaging Het
Ifnab A G 4: 88,690,834 S132P probably benign Het
Ing5 T C 1: 93,812,420 I70T probably damaging Het
Ints1 T C 5: 139,772,438 N228S probably damaging Het
Itgb6 T A 2: 60,627,841 I523F probably benign Het
Kat2b T C 17: 53,638,537 F328S possibly damaging Het
Kbtbd3 A T 9: 4,316,950 I34F possibly damaging Het
Klhl11 A T 11: 100,463,522 I491N probably damaging Het
Lmo7 A T 14: 101,918,053 probably benign Het
Lrp1 G T 10: 127,592,136 P523T probably damaging Het
Lrp1b T A 2: 40,730,798 D3556V probably benign Het
Lrp2 T A 2: 69,535,043 H262L probably benign Het
Lrrc27 T A 7: 139,226,187 I256K probably benign Het
Lrrc47 G A 4: 154,019,632 R523K probably benign Het
Lrrc71 A T 3: 87,745,777 S111T probably benign Het
Map3k7cl T C 16: 87,581,212 V72A probably damaging Het
Mphosph10 G T 7: 64,388,855 probably benign Het
Nlrp4a T C 7: 26,449,232 probably benign Het
Nsd2 A T 5: 33,891,551 M1140L probably damaging Het
Nt5dc3 T C 10: 86,825,291 M440T possibly damaging Het
Olfr183 T C 16: 59,000,087 V134A probably benign Het
Oog4 A T 4: 143,437,689 L424Q probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Papola T C 12: 105,818,838 F410L probably benign Het
Pcdh10 A G 3: 45,379,497 E82G probably damaging Het
Pcdh20 T C 14: 88,469,003 Y287C probably damaging Het
Pld1 T A 3: 28,088,638 probably null Het
Plekha8 G A 6: 54,616,758 probably null Het
Ppbp C T 5: 90,769,343 T93M possibly damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rab3gap2 C T 1: 185,262,694 T810M possibly damaging Het
Rassf9 A G 10: 102,546,011 N418S possibly damaging Het
Rnf20 C G 4: 49,650,176 R582G possibly damaging Het
Serpine2 T C 1: 79,821,430 I36V probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc24a2 A T 4: 87,227,292 V175E probably damaging Het
Sned1 T C 1: 93,285,951 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 GCC G 2: 122,059,447 probably null Het
Tecrl C T 5: 83,294,659 C189Y probably damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Thnsl2 T C 6: 71,139,790 Y126C probably damaging Het
Tll2 T C 19: 41,183,313 probably null Het
Ubqln4 C T 3: 88,555,969 S147L probably benign Het
Ugt2b5 A T 5: 87,140,258 C17S probably benign Het
Vps41 A T 13: 18,842,247 Q505L probably benign Het
Zfp386 T C 12: 116,054,816 M35T possibly damaging Het
Zfp777 T C 6: 48,044,476 M71V possibly damaging Het
Zfp938 A T 10: 82,227,828 L34Q probably damaging Het
Zfp974 A T 7: 27,920,695 probably null Het
Other mutations in Dusp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Dusp11 APN 6 85952370 splice site probably benign
IGL01584:Dusp11 APN 6 85953394 missense probably damaging 1.00
IGL02276:Dusp11 APN 6 85958617 missense probably damaging 1.00
IGL02727:Dusp11 APN 6 85961492 missense probably damaging 1.00
R0413:Dusp11 UTSW 6 85952370 splice site probably benign
R1669:Dusp11 UTSW 6 85950026 missense probably benign 0.05
R2115:Dusp11 UTSW 6 85958669 missense probably damaging 1.00
R4610:Dusp11 UTSW 6 85950055 missense probably damaging 1.00
R4678:Dusp11 UTSW 6 85953381 missense probably damaging 0.98
R5288:Dusp11 UTSW 6 85947605 makesense probably null
R5386:Dusp11 UTSW 6 85947605 makesense probably null
R5756:Dusp11 UTSW 6 85952357 missense probably damaging 1.00
R5987:Dusp11 UTSW 6 85959233 nonsense probably null
R6591:Dusp11 UTSW 6 85961525 missense possibly damaging 0.53
R6691:Dusp11 UTSW 6 85961525 missense possibly damaging 0.53
R7684:Dusp11 UTSW 6 85950560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTCAGAGGGCCACTTACCTCTAC -3'
(R):5'- TGCCTGGGACTCGTTTCATTGC -3'

Sequencing Primer
(F):5'- GCCACTTACCTCTACTTTATAATAGC -3'
(R):5'- AGAGAATGCTGGCTCTCAATC -3'
Posted On2013-04-24