Incidental Mutation 'R0372:Kat2b'
ID30566
Institutional Source Beutler Lab
Gene Symbol Kat2b
Ensembl Gene ENSMUSG00000000708
Gene NameK(lysine) acetyltransferase 2B
SynonymsPcaf, A930006P13Rik
MMRRC Submission 038578-MU
Accession Numbers

Genbank: NM_020005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0372 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location53566861-53672720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53638537 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 328 (F328S)
Ref Sequence ENSEMBL: ENSMUSP00000000724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000724] [ENSMUST00000164390]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000724
AA Change: F328S

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000724
Gene: ENSMUSG00000000708
AA Change: F328S

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 32 55 N/A INTRINSIC
Pfam:PCAF_N 56 308 6.2e-114 PFAM
low complexity region 461 472 N/A INTRINSIC
Pfam:Acetyltransf_7 522 605 1.5e-11 PFAM
Pfam:Acetyltransf_1 530 604 3.2e-11 PFAM
low complexity region 643 659 N/A INTRINSIC
BROMO 702 810 1.08e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164390
SMART Domains Protein: ENSMUSP00000127659
Gene: ENSMUSG00000000708

DomainStartEndE-ValueType
Pfam:PCAF_N 1 210 6e-122 PFAM
Meta Mutation Damage Score 0.8614 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CBP and p300 are large nuclear proteins that bind to many sequence-specific factors involved in cell growth and/or differentiation, including c-jun and the adenoviral oncoprotein E1A. The protein encoded by this gene associates with p300/CBP. It has in vitro and in vivo binding activity with CBP and p300, and competes with E1A for binding sites in p300/CBP. It has histone acetyl transferase activity with core histones and nucleosome core particles, indicating that this protein plays a direct role in transcriptional regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abrnomal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(122) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(119)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik T A 14: 63,973,482 Q99L probably damaging Het
Abca2 A G 2: 25,437,353 Y641C probably damaging Het
Abhd10 A G 16: 45,736,891 probably null Het
Acan G T 7: 79,100,601 A1707S probably benign Het
Ankrd61 T A 5: 143,891,175 R284S probably benign Het
Ap3d1 T C 10: 80,723,567 K258E probably damaging Het
Arl6ip6 T G 2: 53,202,921 F153V probably damaging Het
Atp2c2 C A 8: 119,757,441 F930L probably benign Het
Avl9 T C 6: 56,726,324 probably null Het
Axin2 A G 11: 108,923,333 S16G probably damaging Het
Axin2 T A 11: 108,924,110 probably benign Het
Bbs7 A T 3: 36,602,832 D282E probably benign Het
Ccny A T 18: 9,345,201 V191D probably damaging Het
Cdk11b A G 4: 155,641,500 probably benign Het
Chd1 T A 17: 17,387,290 C367S probably benign Het
Cnnm4 G A 1: 36,498,010 V472M probably damaging Het
Cpb2 T A 14: 75,242,377 I8N probably benign Het
Dusp11 A G 6: 85,958,730 probably benign Het
Elmo1 T C 13: 20,572,459 probably null Het
Gbf1 C T 19: 46,285,704 P1726S probably benign Het
Hal A G 10: 93,507,553 probably benign Het
Hlcs T C 16: 94,138,907 I671V possibly damaging Het
Ifnab A G 4: 88,690,834 S132P probably benign Het
Ing5 T C 1: 93,812,420 I70T probably damaging Het
Ints1 T C 5: 139,772,438 N228S probably damaging Het
Itgb6 T A 2: 60,627,841 I523F probably benign Het
Kbtbd3 A T 9: 4,316,950 I34F possibly damaging Het
Klhl11 A T 11: 100,463,522 I491N probably damaging Het
Lmo7 A T 14: 101,918,053 probably benign Het
Lrp1 G T 10: 127,592,136 P523T probably damaging Het
Lrp1b T A 2: 40,730,798 D3556V probably benign Het
Lrp2 T A 2: 69,535,043 H262L probably benign Het
Lrrc27 T A 7: 139,226,187 I256K probably benign Het
Lrrc47 G A 4: 154,019,632 R523K probably benign Het
Lrrc71 A T 3: 87,745,777 S111T probably benign Het
Map3k7cl T C 16: 87,581,212 V72A probably damaging Het
Mphosph10 G T 7: 64,388,855 probably benign Het
Nlrp4a T C 7: 26,449,232 probably benign Het
Nsd2 A T 5: 33,891,551 M1140L probably damaging Het
Nt5dc3 T C 10: 86,825,291 M440T possibly damaging Het
Olfr183 T C 16: 59,000,087 V134A probably benign Het
Oog4 A T 4: 143,437,689 L424Q probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Papola T C 12: 105,818,838 F410L probably benign Het
Pcdh10 A G 3: 45,379,497 E82G probably damaging Het
Pcdh20 T C 14: 88,469,003 Y287C probably damaging Het
Pld1 T A 3: 28,088,638 probably null Het
Plekha8 G A 6: 54,616,758 probably null Het
Ppbp C T 5: 90,769,343 T93M possibly damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rab3gap2 C T 1: 185,262,694 T810M possibly damaging Het
Rassf9 A G 10: 102,546,011 N418S possibly damaging Het
Rnf20 C G 4: 49,650,176 R582G possibly damaging Het
Serpine2 T C 1: 79,821,430 I36V probably damaging Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Slc24a2 A T 4: 87,227,292 V175E probably damaging Het
Sned1 T C 1: 93,285,951 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spg11 GCC G 2: 122,059,447 probably null Het
Tecrl C T 5: 83,294,659 C189Y probably damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Thnsl2 T C 6: 71,139,790 Y126C probably damaging Het
Tll2 T C 19: 41,183,313 probably null Het
Ubqln4 C T 3: 88,555,969 S147L probably benign Het
Ugt2b5 A T 5: 87,140,258 C17S probably benign Het
Vps41 A T 13: 18,842,247 Q505L probably benign Het
Zfp386 T C 12: 116,054,816 M35T possibly damaging Het
Zfp777 T C 6: 48,044,476 M71V possibly damaging Het
Zfp938 A T 10: 82,227,828 L34Q probably damaging Het
Zfp974 A T 7: 27,920,695 probably null Het
Other mutations in Kat2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Kat2b APN 17 53663623 missense possibly damaging 0.46
IGL00793:Kat2b APN 17 53665824 missense probably benign 0.00
IGL01628:Kat2b APN 17 53610897 missense possibly damaging 0.89
IGL02494:Kat2b APN 17 53653205 missense probably damaging 1.00
IGL03347:Kat2b APN 17 53624351 critical splice acceptor site probably null
cakewalk UTSW 17 53638522 missense probably damaging 1.00
D605:Kat2b UTSW 17 53629330 missense probably damaging 1.00
R0060:Kat2b UTSW 17 53654543 missense probably damaging 1.00
R0225:Kat2b UTSW 17 53641210 missense probably damaging 1.00
R0638:Kat2b UTSW 17 53644743 splice site probably benign
R0639:Kat2b UTSW 17 53567538 missense probably benign 0.38
R0780:Kat2b UTSW 17 53567448 missense unknown
R1240:Kat2b UTSW 17 53624397 missense probably benign 0.00
R2346:Kat2b UTSW 17 53610904 missense probably benign 0.07
R3402:Kat2b UTSW 17 53665853 missense probably damaging 1.00
R3776:Kat2b UTSW 17 53567581 splice site probably null
R4009:Kat2b UTSW 17 53644741 splice site probably null
R4011:Kat2b UTSW 17 53644741 splice site probably null
R4543:Kat2b UTSW 17 53653140 missense probably benign
R4598:Kat2b UTSW 17 53670798 missense probably benign 0.02
R4785:Kat2b UTSW 17 53653203 missense possibly damaging 0.81
R5079:Kat2b UTSW 17 53663638 missense probably damaging 1.00
R5475:Kat2b UTSW 17 53663581 missense probably damaging 1.00
R6993:Kat2b UTSW 17 53638522 missense probably damaging 1.00
R7047:Kat2b UTSW 17 53663569 missense probably benign 0.01
R7058:Kat2b UTSW 17 53665866 missense probably benign 0.00
R7199:Kat2b UTSW 17 53670678 missense probably damaging 1.00
R7276:Kat2b UTSW 17 53624422 missense probably damaging 1.00
R7418:Kat2b UTSW 17 53610925 missense possibly damaging 0.94
R7535:Kat2b UTSW 17 53624403 missense probably damaging 1.00
R7561:Kat2b UTSW 17 53641258 missense probably benign 0.22
R7723:Kat2b UTSW 17 53638387 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTGACAGCTTACCTCGGTACGAAAC -3'
(R):5'- GCAGCTCTCATAGCCTAAAGGCAAC -3'

Sequencing Primer
(F):5'- TACGAAACCACAAAGGTGTTTGG -3'
(R):5'- gctgagagactgtcccacc -3'
Posted On2013-04-24