Mutagenetix > Incidental Mutations

Incidental Mutation 'R0373:Uggt1'

30570

Institutional Source

Beutler Lab

Gene Symbol

Uggt1

Ensembl Gene

ENSMUSG00000037470

Gene Name

UDP-glucose glycoprotein glucosyltransferase 1

Synonyms

Ugcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik

MMRRC Submission

038579-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.701) question?

Stock #

R0373 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36140027-36244720 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36179670 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 59 (S59P)

Ref Sequence

ENSEMBL: ENSMUSP00000134078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000173166] [ENSMUST00000174266]

Predicted Effect

probably benign
Transcript: ENSMUST00000046875
AA Change: S676P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: S676P

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
Pfam:UDP-g_GGTase	44	1222	N/A	PFAM
SCOP:d1ga8a_	1256	1521	3e-45	SMART
Blast:BROMO	1414	1453	3e-17	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000173166
AA Change: S59P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000174266

SMART Domains

Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174716

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.8%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	A	T	3: 138,173,582	L235Q	probably damaging	Het
Adam6b	T	A	12: 113,490,655	V364D	probably benign	Het
Akap13	T	C	7: 75,609,929	L767P	probably benign	Het
Akap13	T	A	7: 75,730,500	S2193T	probably damaging	Het
Anapc11	T	C	11: 120,605,377	V69A	probably benign	Het
Ankmy1	C	T	1: 92,896,190	R118Q	probably damaging	Het
Ankrd27	T	C	7: 35,638,053	S931P	probably benign	Het
Atp6v1c2	G	A	12: 17,288,168	R280C	probably damaging	Het
Bbs10	T	A	10: 111,300,052	I342N	probably damaging	Het
Calhm2	T	C	19: 47,132,950	D260G	possibly damaging	Het
Camk2a	A	G	18: 60,958,238	E264G	probably damaging	Het
Ccdc146	T	A	5: 21,319,545	M270L	probably benign	Het
Cdc16	A	G	8: 13,779,264	T517A	probably benign	Het
Ces1g	T	C	8: 93,331,193	H160R	probably benign	Het
Chst4	T	C	8: 110,030,394	N196S	probably damaging	Het
Ciz1	A	T	2: 32,367,467	N175Y	probably damaging	Het
Cyb5r4	G	A	9: 87,027,040	V57I	probably damaging	Het
Cyth3	A	G	5: 143,684,426		probably benign	Het
Def6	A	G	17: 28,220,180	E255G	probably damaging	Het
Dhtkd1	T	G	2: 5,911,870	Q665P	probably damaging	Het
Dsg3	A	C	18: 20,539,747	D825A	probably damaging	Het
Eif3m	T	C	2: 105,005,000	T242A	probably benign	Het
Emilin3	A	G	2: 160,909,817	F101L	probably benign	Het
Epha7	A	G	4: 28,935,700		probably null	Het
Fam205a1	T	C	4: 42,851,161	I332V	probably benign	Het
Fbxo45	A	T	16: 32,238,405	Y224N	probably damaging	Het
Fhod3	A	T	18: 25,090,104	M836L	possibly damaging	Het
Fut4	C	A	9: 14,751,210	V263F	probably damaging	Het
Ggt1	C	T	10: 75,579,270	T206M	probably benign	Het
Gls	T	C	1: 52,188,699	R79G	probably damaging	Het
Gm436	A	T	4: 144,686,220	M50K	possibly damaging	Het
Grhl1	T	C	12: 24,581,515	S156P	probably benign	Het
Ipo8	C	T	6: 148,775,042	S983N	probably benign	Het
Kcna7	C	T	7: 45,409,444	A385V	probably damaging	Het
Kpnb1	A	T	11: 97,185,090	L40Q	probably damaging	Het
Matn1	A	T	4: 130,950,106	S209C	probably damaging	Het
Mcc	A	G	18: 44,475,222	I501T	probably benign	Het
Mdp1	A	T	14: 55,659,375	F104L	probably damaging	Het
Mib2	A	T	4: 155,656,288	N626K	probably damaging	Het
Mrgprh	T	C	17: 12,876,956	S28P	possibly damaging	Het
Mup-ps23	T	A	4: 61,856,149		noncoding transcript	Het
Myh15	A	G	16: 49,182,959	T1794A	possibly damaging	Het
Myo18a	C	G	11: 77,821,042	P680A	probably benign	Het
Myom2	G	T	8: 15,098,419	D532Y	possibly damaging	Het
Ndufaf5	A	G	2: 140,170,881	N57S	probably benign	Het
Nectin3	C	T	16: 46,458,187	V282M	probably damaging	Het
Nup188	G	T	2: 30,330,988	D997Y	probably damaging	Het
Olfm3	T	C	3: 115,122,805	V462A	probably damaging	Het
Olfr1044	A	C	2: 86,171,706	F37C	probably damaging	Het
Olfr1225	A	T	2: 89,170,413	F266L	probably benign	Het
Olfr305	A	T	7: 86,363,805	C177*	probably null	Het
Opcml	A	G	9: 28,813,398	H164R	possibly damaging	Het
Pacrg	A	G	17: 10,403,418	I209T	probably damaging	Het
Pcf11	T	C	7: 92,661,215	M522V	probably benign	Het
Pck1	T	A	2: 173,153,390	M1K	probably null	Het
Pcm1	G	T	8: 41,276,111	E707*	probably null	Het
Pcsk5	G	A	19: 17,654,849	R318W	probably damaging	Het
Phf11d	A	T	14: 59,353,344	M188K	possibly damaging	Het
Ppip5k2	A	T	1: 97,740,537	C615*	probably null	Het
Prkdc	T	A	16: 15,791,927	S3132T	probably damaging	Het
Prl2c5	A	T	13: 13,183,024		probably benign	Het
Prpsap2	A	G	11: 61,741,000	I177T	possibly damaging	Het
Rad50	A	G	11: 53,650,519	S1297P	probably damaging	Het
Rasip1	T	A	7: 45,635,244	N678K	possibly damaging	Het
Rubcn	A	G	16: 32,835,980	S544P	probably damaging	Het
Rwdd2a	A	T	9: 86,574,400	T210S	possibly damaging	Het
Scd2	A	G	19: 44,303,040	D306G	probably damaging	Het
Sema3b	T	C	9: 107,602,918	N207S	probably benign	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Sipa1l2	C	A	8: 125,464,410	C947F	probably damaging	Het
Slc12a1	A	T	2: 125,226,031	T1013S	probably damaging	Het
Slc18a2	A	T	19: 59,287,367	I461L	probably benign	Het
Slc1a6	C	A	10: 78,801,922	Y427*	probably null	Het
Slc30a4	A	T	2: 122,689,399	I231K	probably damaging	Het
Sos1	G	T	17: 80,453,763	A168D	probably damaging	Het
Sptb	T	C	12: 76,621,371	S651G	probably benign	Het
Stk36	T	C	1: 74,633,620	L1007P	probably damaging	Het
Tek	A	T	4: 94,804,341	N229Y	probably damaging	Het
Tep1	A	G	14: 50,836,768	F1887L	possibly damaging	Het
Tet1	A	T	10: 62,878,209	C602*	probably null	Het
Tnfrsf19	A	G	14: 60,972,036	S262P	possibly damaging	Het
Trim5	T	C	7: 104,265,684	I393V	probably benign	Het
Trpm6	A	G	19: 18,853,587	E1272G	probably benign	Het
Ttc21b	A	T	2: 66,188,326	Y1246N	probably damaging	Het
Ttll3	T	A	6: 113,398,777	L151H	probably damaging	Het
U2surp	C	T	9: 95,484,443	V470I	probably benign	Het
Ubr1	A	T	2: 120,946,657	Y276N	probably benign	Het
Unc45a	T	C	7: 80,326,344	T796A	probably damaging	Het
Unc5b	C	A	10: 60,778,940	V193F	possibly damaging	Het
Upp1	G	T	11: 9,129,590	M50I	probably benign	Het
Vps18	C	T	2: 119,293,905	R438C	probably damaging	Het
Zfp715	T	C	7: 43,299,336	Y400C	possibly damaging	Het
Zfp955b	T	C	17: 33,302,522	Y322H	probably benign	Het

Other mutations in Uggt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Uggt1	APN	1	36179552	splice site	probably benign
IGL00817:Uggt1	APN	1	36185932	missense	probably benign	0.03
IGL01395:Uggt1	APN	1	36155077	missense	probably damaging	1.00
IGL01609:Uggt1	APN	1	36182474	missense	probably damaging	1.00
IGL01619:Uggt1	APN	1	36161694	missense	probably damaging	0.99
IGL02077:Uggt1	APN	1	36176794	missense	probably damaging	0.99
IGL02313:Uggt1	APN	1	36184484	missense	probably damaging	0.99
IGL02341:Uggt1	APN	1	36164519	makesense	probably null
IGL02346:Uggt1	APN	1	36179670	missense	probably benign	0.00
IGL02447:Uggt1	APN	1	36150142	missense	probably damaging	1.00
IGL02883:Uggt1	APN	1	36177615	missense	probably benign	0.03
IGL02930:Uggt1	APN	1	36157456	missense	probably benign	0.01
IGL03153:Uggt1	APN	1	36202818	missense	possibly damaging	0.94
IGL03162:Uggt1	APN	1	36207956	missense	probably damaging	1.00
IGL03170:Uggt1	APN	1	36163261	missense	probably damaging	1.00
IGL03266:Uggt1	APN	1	36150048	missense	probably damaging	1.00
K3955:Uggt1	UTSW	1	36162353	missense	probably benign	0.37
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0167:Uggt1	UTSW	1	36170197	critical splice donor site	probably null
R0502:Uggt1	UTSW	1	36159946	missense	probably damaging	1.00
R0546:Uggt1	UTSW	1	36195971	missense	probably benign	0.00
R0610:Uggt1	UTSW	1	36165506	splice site	probably benign
R0671:Uggt1	UTSW	1	36155128	missense	probably damaging	1.00
R0760:Uggt1	UTSW	1	36161724	missense	possibly damaging	0.68
R0825:Uggt1	UTSW	1	36158143	missense	probably benign	0.01
R0827:Uggt1	UTSW	1	36156313	critical splice acceptor site	probably null
R0884:Uggt1	UTSW	1	36175078	missense	probably benign	0.00
R1112:Uggt1	UTSW	1	36173546	missense	possibly damaging	0.54
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1592:Uggt1	UTSW	1	36202858	missense	probably benign	0.04
R1730:Uggt1	UTSW	1	36221261	missense	probably benign	0.05
R1923:Uggt1	UTSW	1	36179613	missense	probably damaging	0.99
R1970:Uggt1	UTSW	1	36151781	missense	probably damaging	1.00
R2086:Uggt1	UTSW	1	36192414	missense	probably null	1.00
R2829:Uggt1	UTSW	1	36162294	missense	probably benign	0.38
R3431:Uggt1	UTSW	1	36210059	nonsense	probably null
R3432:Uggt1	UTSW	1	36210059	nonsense	probably null
R3725:Uggt1	UTSW	1	36182507	nonsense	probably null
R3880:Uggt1	UTSW	1	36176804	intron	probably benign
R4052:Uggt1	UTSW	1	36164489	missense	probably damaging	0.98
R4133:Uggt1	UTSW	1	36158159	missense	probably damaging	1.00
R4489:Uggt1	UTSW	1	36146668	nonsense	probably null
R4570:Uggt1	UTSW	1	36150073	missense	probably damaging	1.00
R4866:Uggt1	UTSW	1	36202855	nonsense	probably null
R4895:Uggt1	UTSW	1	36156264	missense	probably damaging	1.00
R4900:Uggt1	UTSW	1	36202855	nonsense	probably null
R5372:Uggt1	UTSW	1	36244060	splice site	probably benign
R5385:Uggt1	UTSW	1	36184412	missense	probably damaging	1.00
R5652:Uggt1	UTSW	1	36216153	nonsense	probably null
R5694:Uggt1	UTSW	1	36179656	missense	probably damaging	1.00
R5732:Uggt1	UTSW	1	36161771	splice site	probably null
R5893:Uggt1	UTSW	1	36227628	splice site	probably null
R6191:Uggt1	UTSW	1	36162208	missense	probably damaging	0.98
R6247:Uggt1	UTSW	1	36163228	missense	probably damaging	1.00
R6259:Uggt1	UTSW	1	36234916	missense	probably benign	0.00
R6399:Uggt1	UTSW	1	36163366	missense	possibly damaging	0.90
R6439:Uggt1	UTSW	1	36174951	missense	possibly damaging	0.95
R6468:Uggt1	UTSW	1	36173450	missense	probably benign	0.00
R6788:Uggt1	UTSW	1	36230688	missense	probably benign	0.00
R7165:Uggt1	UTSW	1	36155107	missense	probably benign	0.41
R7255:Uggt1	UTSW	1	36146106	missense	probably damaging	1.00
R7273:Uggt1	UTSW	1	36162221	missense	probably damaging	0.99
R7469:Uggt1	UTSW	1	36151733	missense	probably damaging	1.00
R7490:Uggt1	UTSW	1	36164508	missense	probably benign	0.01
R7570:Uggt1	UTSW	1	36185838	missense	probably benign	0.09
R7612:Uggt1	UTSW	1	36163235	missense	probably damaging	0.99
R7759:Uggt1	UTSW	1	36146725	missense	possibly damaging	0.81
R7792:Uggt1	UTSW	1	36207984	missense	probably damaging	1.00
R7816:Uggt1	UTSW	1	36163315	missense	possibly damaging	0.95
R7858:Uggt1	UTSW	1	36156258	missense	probably damaging	1.00
R7887:Uggt1	UTSW	1	36208034	missense	probably damaging	0.99
R8040:Uggt1	UTSW	1	36211473	missense	possibly damaging	0.70
R8093:Uggt1	UTSW	1	36227485	missense	probably damaging	1.00
R8245:Uggt1	UTSW	1	36165564	missense	probably damaging	1.00
R8338:Uggt1	UTSW	1	36227521	missense	probably damaging	1.00
R8442:Uggt1	UTSW	1	36173487	missense	probably damaging	0.99
X0022:Uggt1	UTSW	1	36165555	missense	possibly damaging	0.67
Z1088:Uggt1	UTSW	1	36174191	missense	probably damaging	1.00
Z1176:Uggt1	UTSW	1	36161695	missense	probably damaging	1.00
Z1177:Uggt1	UTSW	1	36155073	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ACCCCACCTTAAACTCCTGAGAGTG -3'
(R):5'- CTGGCACCCCAGTGTTTCAATAGAG -3'

Sequencing Primer
(F):5'- gccatctcttcagcccc -3'
(R):5'- CCCCAGTGTTTCAATAGAGTTAGAGG -3'

Posted On

2013-04-24