Incidental Mutation 'R0373:Gls'
ID 30571
Institutional Source Beutler Lab
Gene Symbol Gls
Ensembl Gene ENSMUSG00000026103
Gene Name glutaminase
Synonyms B230365M23Rik
MMRRC Submission 038579-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0373 (G1)
Quality Score 224
Status Not validated
Chromosome 1
Chromosomal Location 52202607-52272391 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52227858 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 79 (R79G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114510] [ENSMUST00000114512] [ENSMUST00000114513] [ENSMUST00000155587]
AlphaFold D3Z7P3
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114509
SMART Domains Protein: ENSMUSP00000110154
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
Pfam:Glutaminase 18 208 2.9e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114510
AA Change: R549G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110155
Gene: ENSMUSG00000026103
AA Change: R549G

DomainStartEndE-ValueType
low complexity region 56 77 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
Pfam:Glutaminase 249 535 3e-127 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114512
AA Change: R366G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110157
Gene: ENSMUSG00000026103
AA Change: R366G

DomainStartEndE-ValueType
Pfam:Glutaminase 66 352 1.7e-125 PFAM
ANK 407 437 3.9e-6 SMART
ANK 441 470 3.6e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114513
AA Change: R549G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110158
Gene: ENSMUSG00000026103
AA Change: R549G

DomainStartEndE-ValueType
low complexity region 56 77 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
Pfam:Glutaminase 249 535 4.2e-123 PFAM
ANK 590 620 6.02e-4 SMART
ANK 624 653 5.69e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123324
Predicted Effect probably damaging
Transcript: ENSMUST00000129107
AA Change: R79G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121408
Gene: ENSMUSG00000026103
AA Change: R79G

DomainStartEndE-ValueType
Pfam:Glutaminase 5 66 1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139273
Predicted Effect possibly damaging
Transcript: ENSMUST00000155587
AA Change: R220G

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115358
Gene: ENSMUSG00000026103
AA Change: R220G

DomainStartEndE-ValueType
Pfam:Glutaminase 1 206 2.4e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156887
AA Change: R79G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116901
Gene: ENSMUSG00000026103
AA Change: R79G

DomainStartEndE-ValueType
Pfam:Glutaminase 5 66 3.1e-26 PFAM
ANK 121 151 6.02e-4 SMART
ANK 155 184 5.69e2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations die within 1 day postnatally with abnormal respiratory function and goal-oriented behavior toward dam. Mice homozygous for another allele exhibit abnormal TNFA-stimulated astrocyte extracellular vesicle release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A T 3: 137,879,343 (GRCm39) L235Q probably damaging Het
Aadacl4fm4 A T 4: 144,412,790 (GRCm39) M50K possibly damaging Het
Adam6b T A 12: 113,454,275 (GRCm39) V364D probably benign Het
Akap13 T C 7: 75,259,677 (GRCm39) L767P probably benign Het
Akap13 T A 7: 75,380,248 (GRCm39) S2193T probably damaging Het
Anapc11 T C 11: 120,496,203 (GRCm39) V69A probably benign Het
Ankmy1 C T 1: 92,823,912 (GRCm39) R118Q probably damaging Het
Ankrd27 T C 7: 35,337,478 (GRCm39) S931P probably benign Het
Atp6v1c2 G A 12: 17,338,169 (GRCm39) R280C probably damaging Het
Bbs10 T A 10: 111,135,913 (GRCm39) I342N probably damaging Het
Calhm2 T C 19: 47,121,389 (GRCm39) D260G possibly damaging Het
Camk2a A G 18: 61,091,310 (GRCm39) E264G probably damaging Het
Ccdc146 T A 5: 21,524,543 (GRCm39) M270L probably benign Het
Cdc16 A G 8: 13,829,264 (GRCm39) T517A probably benign Het
Ces1g T C 8: 94,057,821 (GRCm39) H160R probably benign Het
Chst4 T C 8: 110,757,026 (GRCm39) N196S probably damaging Het
Ciz1 A T 2: 32,257,479 (GRCm39) N175Y probably damaging Het
Cyb5r4 G A 9: 86,909,093 (GRCm39) V57I probably damaging Het
Cyth3 A G 5: 143,670,181 (GRCm39) probably benign Het
Def6 A G 17: 28,439,154 (GRCm39) E255G probably damaging Het
Dhtkd1 T G 2: 5,916,681 (GRCm39) Q665P probably damaging Het
Dsg3 A C 18: 20,672,804 (GRCm39) D825A probably damaging Het
Eif3m T C 2: 104,835,345 (GRCm39) T242A probably benign Het
Emilin3 A G 2: 160,751,737 (GRCm39) F101L probably benign Het
Epha7 A G 4: 28,935,700 (GRCm39) probably null Het
Fbxo45 A T 16: 32,057,223 (GRCm39) Y224N probably damaging Het
Fhod3 A T 18: 25,223,161 (GRCm39) M836L possibly damaging Het
Fut4 C A 9: 14,662,506 (GRCm39) V263F probably damaging Het
Ggt1 C T 10: 75,415,104 (GRCm39) T206M probably benign Het
Grhl1 T C 12: 24,631,514 (GRCm39) S156P probably benign Het
Ipo8 C T 6: 148,676,540 (GRCm39) S983N probably benign Het
Kcna7 C T 7: 45,058,868 (GRCm39) A385V probably damaging Het
Kpnb1 A T 11: 97,075,916 (GRCm39) L40Q probably damaging Het
Matn1 A T 4: 130,677,417 (GRCm39) S209C probably damaging Het
Mcc A G 18: 44,608,289 (GRCm39) I501T probably benign Het
Mdp1 A T 14: 55,896,832 (GRCm39) F104L probably damaging Het
Mib2 A T 4: 155,740,745 (GRCm39) N626K probably damaging Het
Mrgprh T C 17: 13,095,843 (GRCm39) S28P possibly damaging Het
Mup-ps23 T A 4: 61,774,386 (GRCm39) noncoding transcript Het
Myh15 A G 16: 49,003,322 (GRCm39) T1794A possibly damaging Het
Myo18a C G 11: 77,711,868 (GRCm39) P680A probably benign Het
Myom2 G T 8: 15,148,419 (GRCm39) D532Y possibly damaging Het
Ndufaf5 A G 2: 140,012,801 (GRCm39) N57S probably benign Het
Nectin3 C T 16: 46,278,550 (GRCm39) V282M probably damaging Het
Nup188 G T 2: 30,221,000 (GRCm39) D997Y probably damaging Het
Olfm3 T C 3: 114,916,454 (GRCm39) V462A probably damaging Het
Opcml A G 9: 28,724,694 (GRCm39) H164R possibly damaging Het
Or14a259 A T 7: 86,013,013 (GRCm39) C177* probably null Het
Or4c120 A T 2: 89,000,757 (GRCm39) F266L probably benign Het
Or8u9 A C 2: 86,002,050 (GRCm39) F37C probably damaging Het
Pacrg A G 17: 10,622,347 (GRCm39) I209T probably damaging Het
Pcf11 T C 7: 92,310,423 (GRCm39) M522V probably benign Het
Pck1 T A 2: 172,995,183 (GRCm39) M1K probably null Het
Pcm1 G T 8: 41,729,148 (GRCm39) E707* probably null Het
Pcsk5 G A 19: 17,632,213 (GRCm39) R318W probably damaging Het
Phf11d A T 14: 59,590,793 (GRCm39) M188K possibly damaging Het
Ppip5k2 A T 1: 97,668,262 (GRCm39) C615* probably null Het
Prkdc T A 16: 15,609,791 (GRCm39) S3132T probably damaging Het
Prl2c5 A T 13: 13,357,609 (GRCm39) probably benign Het
Prpsap2 A G 11: 61,631,826 (GRCm39) I177T possibly damaging Het
Rad50 A G 11: 53,541,346 (GRCm39) S1297P probably damaging Het
Rasip1 T A 7: 45,284,668 (GRCm39) N678K possibly damaging Het
Rubcn A G 16: 32,656,350 (GRCm39) S544P probably damaging Het
Rwdd2a A T 9: 86,456,453 (GRCm39) T210S possibly damaging Het
Scd2 A G 19: 44,291,479 (GRCm39) D306G probably damaging Het
Sema3b T C 9: 107,480,117 (GRCm39) N207S probably benign Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Sipa1l2 C A 8: 126,191,149 (GRCm39) C947F probably damaging Het
Slc12a1 A T 2: 125,067,951 (GRCm39) T1013S probably damaging Het
Slc18a2 A T 19: 59,275,799 (GRCm39) I461L probably benign Het
Slc1a6 C A 10: 78,637,756 (GRCm39) Y427* probably null Het
Slc30a4 A T 2: 122,531,319 (GRCm39) I231K probably damaging Het
Sos1 G T 17: 80,761,192 (GRCm39) A168D probably damaging Het
Spata31f1a T C 4: 42,851,161 (GRCm39) I332V probably benign Het
Sptb T C 12: 76,668,145 (GRCm39) S651G probably benign Het
Stk36 T C 1: 74,672,779 (GRCm39) L1007P probably damaging Het
Tek A T 4: 94,692,578 (GRCm39) N229Y probably damaging Het
Tep1 A G 14: 51,074,225 (GRCm39) F1887L possibly damaging Het
Tet1 A T 10: 62,713,988 (GRCm39) C602* probably null Het
Tnfrsf19 A G 14: 61,209,485 (GRCm39) S262P possibly damaging Het
Trim5 T C 7: 103,914,891 (GRCm39) I393V probably benign Het
Trpm6 A G 19: 18,830,951 (GRCm39) E1272G probably benign Het
Ttc21b A T 2: 66,018,670 (GRCm39) Y1246N probably damaging Het
Ttll3 T A 6: 113,375,738 (GRCm39) L151H probably damaging Het
U2surp C T 9: 95,366,496 (GRCm39) V470I probably benign Het
Ubr1 A T 2: 120,777,138 (GRCm39) Y276N probably benign Het
Uggt1 A G 1: 36,218,751 (GRCm39) S59P probably benign Het
Unc45a T C 7: 79,976,092 (GRCm39) T796A probably damaging Het
Unc5b C A 10: 60,614,719 (GRCm39) V193F possibly damaging Het
Upp1 G T 11: 9,079,590 (GRCm39) M50I probably benign Het
Vps18 C T 2: 119,124,386 (GRCm39) R438C probably damaging Het
Zfp715 T C 7: 42,948,760 (GRCm39) Y400C possibly damaging Het
Zfp955b T C 17: 33,521,496 (GRCm39) Y322H probably benign Het
Other mutations in Gls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Gls APN 1 52,227,867 (GRCm39) missense probably damaging 1.00
IGL01366:Gls APN 1 52,207,558 (GRCm39) missense probably damaging 1.00
IGL01367:Gls APN 1 52,207,558 (GRCm39) missense probably damaging 1.00
IGL01832:Gls APN 1 52,207,568 (GRCm39) splice site probably null
IGL02045:Gls APN 1 52,258,674 (GRCm39) missense probably benign 0.01
LCD18:Gls UTSW 1 52,222,526 (GRCm39) intron probably benign
R0268:Gls UTSW 1 52,271,853 (GRCm39) small deletion probably benign
R0590:Gls UTSW 1 52,251,534 (GRCm39) unclassified probably benign
R1440:Gls UTSW 1 52,230,293 (GRCm39) missense possibly damaging 0.59
R1628:Gls UTSW 1 52,271,835 (GRCm39) missense probably benign 0.06
R3684:Gls UTSW 1 52,205,452 (GRCm39) missense probably damaging 1.00
R3697:Gls UTSW 1 52,238,923 (GRCm39) missense possibly damaging 0.65
R3778:Gls UTSW 1 52,208,071 (GRCm39) missense probably benign 0.05
R3824:Gls UTSW 1 52,272,147 (GRCm39) missense possibly damaging 0.83
R4062:Gls UTSW 1 52,235,907 (GRCm39) missense probably damaging 1.00
R4441:Gls UTSW 1 52,235,322 (GRCm39) critical splice donor site probably null
R4740:Gls UTSW 1 52,271,947 (GRCm39) missense probably damaging 0.99
R4816:Gls UTSW 1 52,239,104 (GRCm39) intron probably benign
R5281:Gls UTSW 1 52,230,316 (GRCm39) missense probably damaging 1.00
R5712:Gls UTSW 1 52,235,911 (GRCm39) missense probably damaging 1.00
R6163:Gls UTSW 1 52,254,735 (GRCm39) missense probably benign 0.00
R6357:Gls UTSW 1 52,258,665 (GRCm39) missense probably damaging 0.99
R6498:Gls UTSW 1 52,259,198 (GRCm39) missense probably benign
R7187:Gls UTSW 1 52,259,139 (GRCm39) missense probably damaging 1.00
R7413:Gls UTSW 1 52,254,735 (GRCm39) missense probably benign 0.00
R7545:Gls UTSW 1 52,230,311 (GRCm39) missense probably damaging 1.00
R7627:Gls UTSW 1 52,205,425 (GRCm39) missense probably benign 0.00
R7648:Gls UTSW 1 52,235,939 (GRCm39) missense probably damaging 0.99
R7781:Gls UTSW 1 52,251,492 (GRCm39) nonsense probably null
R7979:Gls UTSW 1 52,230,271 (GRCm39) missense probably damaging 0.99
R8488:Gls UTSW 1 52,239,012 (GRCm39) critical splice donor site probably null
R9179:Gls UTSW 1 52,239,015 (GRCm39) missense probably damaging 1.00
R9240:Gls UTSW 1 52,207,553 (GRCm39) missense probably benign 0.00
R9550:Gls UTSW 1 52,251,373 (GRCm39) nonsense probably null
R9667:Gls UTSW 1 52,230,036 (GRCm39) critical splice donor site probably null
R9721:Gls UTSW 1 52,251,427 (GRCm39) missense probably damaging 1.00
Z1176:Gls UTSW 1 52,253,647 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGCACATGGGGCCACACAC -3'
(R):5'- ACACAGGATAAGGCGTGATCTGTTG -3'

Sequencing Primer
(F):5'- GGAAAAACTGTTATCTCCAGTGGC -3'
(R):5'- AAGGCGTGATCTGTTGAAATATG -3'
Posted On 2013-04-24