Incidental Mutation 'R0373:Stk36'
ID30572
Institutional Source Beutler Lab
Gene Symbol Stk36
Ensembl Gene ENSMUSG00000033276
Gene Nameserine/threonine kinase 36
Synonyms1700112N14Rik, Fused
MMRRC Submission 038579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0373 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74601445-74636894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74633620 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1007 (L1007P)
Ref Sequence ENSEMBL: ENSMUSP00000120020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087183] [ENSMUST00000087186] [ENSMUST00000148456]
Predicted Effect probably damaging
Transcript: ENSMUST00000087183
AA Change: L1009P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084430
Gene: ENSMUSG00000033276
AA Change: L1009P

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
Pfam:HEAT_2 1112 1218 7.8e-11 PFAM
Pfam:HEAT_2 1158 1259 3e-11 PFAM
Pfam:HEAT_EZ 1207 1261 4.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000087186
AA Change: L881P
SMART Domains Protein: ENSMUSP00000084433
Gene: ENSMUSG00000033276
AA Change: L881P

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 577 590 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 828 841 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
low complexity region 886 902 N/A INTRINSIC
Pfam:HEAT_2 984 1090 2.9e-10 PFAM
Pfam:HEAT_2 1026 1131 9.6e-11 PFAM
Pfam:HEAT_EZ 1039 1092 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145673
Predicted Effect probably damaging
Transcript: ENSMUST00000148456
AA Change: L1007P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120020
Gene: ENSMUSG00000033276
AA Change: L1007P

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1012 1028 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155473
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family of enzymes. This family member is similar to a Drosophila protein that plays a key role in the Hedgehog signaling pathway. This human protein is a positive regulator of the GLI zinc-finger transcription factors. Knockout studies of the homologous mouse gene suggest that defects in this human gene may lead to congenital hydrocephalus, possibly due to a functional defect in motile cilia. Because Hedgehog signaling is frequently activated in certain kinds of gastrointestinal cancers, it has been suggested that this gene is a target for the treatment of these cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause postnatal growth defects and lethality. Homozygotes for a null allele show hydrocephaly, cranial defects, otitis media and sterility. Homozygotes for another null allele show additional defects in lung and renal development, thymus and spleen atrophy, rhinitis and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A T 3: 138,173,582 L235Q probably damaging Het
Adam6b T A 12: 113,490,655 V364D probably benign Het
Akap13 T C 7: 75,609,929 L767P probably benign Het
Akap13 T A 7: 75,730,500 S2193T probably damaging Het
Anapc11 T C 11: 120,605,377 V69A probably benign Het
Ankmy1 C T 1: 92,896,190 R118Q probably damaging Het
Ankrd27 T C 7: 35,638,053 S931P probably benign Het
Atp6v1c2 G A 12: 17,288,168 R280C probably damaging Het
Bbs10 T A 10: 111,300,052 I342N probably damaging Het
Calhm2 T C 19: 47,132,950 D260G possibly damaging Het
Camk2a A G 18: 60,958,238 E264G probably damaging Het
Ccdc146 T A 5: 21,319,545 M270L probably benign Het
Cdc16 A G 8: 13,779,264 T517A probably benign Het
Ces1g T C 8: 93,331,193 H160R probably benign Het
Chst4 T C 8: 110,030,394 N196S probably damaging Het
Ciz1 A T 2: 32,367,467 N175Y probably damaging Het
Cyb5r4 G A 9: 87,027,040 V57I probably damaging Het
Cyth3 A G 5: 143,684,426 probably benign Het
Def6 A G 17: 28,220,180 E255G probably damaging Het
Dhtkd1 T G 2: 5,911,870 Q665P probably damaging Het
Dsg3 A C 18: 20,539,747 D825A probably damaging Het
Eif3m T C 2: 105,005,000 T242A probably benign Het
Emilin3 A G 2: 160,909,817 F101L probably benign Het
Epha7 A G 4: 28,935,700 probably null Het
Fam205a1 T C 4: 42,851,161 I332V probably benign Het
Fbxo45 A T 16: 32,238,405 Y224N probably damaging Het
Fhod3 A T 18: 25,090,104 M836L possibly damaging Het
Fut4 C A 9: 14,751,210 V263F probably damaging Het
Ggt1 C T 10: 75,579,270 T206M probably benign Het
Gls T C 1: 52,188,699 R79G probably damaging Het
Gm436 A T 4: 144,686,220 M50K possibly damaging Het
Grhl1 T C 12: 24,581,515 S156P probably benign Het
Ipo8 C T 6: 148,775,042 S983N probably benign Het
Kcna7 C T 7: 45,409,444 A385V probably damaging Het
Kpnb1 A T 11: 97,185,090 L40Q probably damaging Het
Matn1 A T 4: 130,950,106 S209C probably damaging Het
Mcc A G 18: 44,475,222 I501T probably benign Het
Mdp1 A T 14: 55,659,375 F104L probably damaging Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Mrgprh T C 17: 12,876,956 S28P possibly damaging Het
Mup-ps23 T A 4: 61,856,149 noncoding transcript Het
Myh15 A G 16: 49,182,959 T1794A possibly damaging Het
Myo18a C G 11: 77,821,042 P680A probably benign Het
Myom2 G T 8: 15,098,419 D532Y possibly damaging Het
Ndufaf5 A G 2: 140,170,881 N57S probably benign Het
Nectin3 C T 16: 46,458,187 V282M probably damaging Het
Nup188 G T 2: 30,330,988 D997Y probably damaging Het
Olfm3 T C 3: 115,122,805 V462A probably damaging Het
Olfr1044 A C 2: 86,171,706 F37C probably damaging Het
Olfr1225 A T 2: 89,170,413 F266L probably benign Het
Olfr305 A T 7: 86,363,805 C177* probably null Het
Opcml A G 9: 28,813,398 H164R possibly damaging Het
Pacrg A G 17: 10,403,418 I209T probably damaging Het
Pcf11 T C 7: 92,661,215 M522V probably benign Het
Pck1 T A 2: 173,153,390 M1K probably null Het
Pcm1 G T 8: 41,276,111 E707* probably null Het
Pcsk5 G A 19: 17,654,849 R318W probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Ppip5k2 A T 1: 97,740,537 C615* probably null Het
Prkdc T A 16: 15,791,927 S3132T probably damaging Het
Prl2c5 A T 13: 13,183,024 probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rad50 A G 11: 53,650,519 S1297P probably damaging Het
Rasip1 T A 7: 45,635,244 N678K possibly damaging Het
Rubcn A G 16: 32,835,980 S544P probably damaging Het
Rwdd2a A T 9: 86,574,400 T210S possibly damaging Het
Scd2 A G 19: 44,303,040 D306G probably damaging Het
Sema3b T C 9: 107,602,918 N207S probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sipa1l2 C A 8: 125,464,410 C947F probably damaging Het
Slc12a1 A T 2: 125,226,031 T1013S probably damaging Het
Slc18a2 A T 19: 59,287,367 I461L probably benign Het
Slc1a6 C A 10: 78,801,922 Y427* probably null Het
Slc30a4 A T 2: 122,689,399 I231K probably damaging Het
Sos1 G T 17: 80,453,763 A168D probably damaging Het
Sptb T C 12: 76,621,371 S651G probably benign Het
Tek A T 4: 94,804,341 N229Y probably damaging Het
Tep1 A G 14: 50,836,768 F1887L possibly damaging Het
Tet1 A T 10: 62,878,209 C602* probably null Het
Tnfrsf19 A G 14: 60,972,036 S262P possibly damaging Het
Trim5 T C 7: 104,265,684 I393V probably benign Het
Trpm6 A G 19: 18,853,587 E1272G probably benign Het
Ttc21b A T 2: 66,188,326 Y1246N probably damaging Het
Ttll3 T A 6: 113,398,777 L151H probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Ubr1 A T 2: 120,946,657 Y276N probably benign Het
Uggt1 A G 1: 36,179,670 S59P probably benign Het
Unc45a T C 7: 80,326,344 T796A probably damaging Het
Unc5b C A 10: 60,778,940 V193F possibly damaging Het
Upp1 G T 11: 9,129,590 M50I probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp715 T C 7: 43,299,336 Y400C possibly damaging Het
Zfp955b T C 17: 33,302,522 Y322H probably benign Het
Other mutations in Stk36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Stk36 APN 1 74634702 missense possibly damaging 0.82
IGL00485:Stk36 APN 1 74634085 missense probably benign
IGL00792:Stk36 APN 1 74611117 missense probably benign 0.01
IGL00941:Stk36 APN 1 74623934 missense possibly damaging 0.85
IGL01324:Stk36 APN 1 74625610 missense possibly damaging 0.66
IGL01538:Stk36 APN 1 74633638 missense probably benign 0.03
IGL02143:Stk36 APN 1 74616569 splice site probably benign
IGL02223:Stk36 APN 1 74623337 missense possibly damaging 0.84
IGL02371:Stk36 APN 1 74622255 missense probably benign 0.13
IGL02618:Stk36 APN 1 74631675 splice site probably benign
IGL02655:Stk36 APN 1 74634535 missense probably damaging 1.00
IGL02993:Stk36 APN 1 74622287 missense probably benign 0.05
IGL03125:Stk36 APN 1 74623313 missense probably damaging 1.00
IGL03242:Stk36 APN 1 74623352 missense possibly damaging 0.70
R0377:Stk36 UTSW 1 74612730 missense probably benign
R0464:Stk36 UTSW 1 74611172 missense probably damaging 0.98
R0520:Stk36 UTSW 1 74602206 unclassified probably benign
R0551:Stk36 UTSW 1 74616621 missense probably benign 0.00
R1118:Stk36 UTSW 1 74632766 missense probably benign 0.29
R1119:Stk36 UTSW 1 74632766 missense probably benign 0.29
R1471:Stk36 UTSW 1 74611155 missense probably benign 0.14
R1915:Stk36 UTSW 1 74634187 missense probably benign 0.08
R2159:Stk36 UTSW 1 74634737 missense probably benign 0.00
R2290:Stk36 UTSW 1 74626144 splice site probably benign
R2897:Stk36 UTSW 1 74632825 missense probably null
R2898:Stk36 UTSW 1 74632825 missense probably null
R4032:Stk36 UTSW 1 74626048 missense probably benign
R4353:Stk36 UTSW 1 74632807 missense possibly damaging 0.53
R4683:Stk36 UTSW 1 74634185 missense probably benign 0.22
R4753:Stk36 UTSW 1 74626096 missense probably benign 0.05
R4891:Stk36 UTSW 1 74603256 missense probably damaging 1.00
R5068:Stk36 UTSW 1 74622345 missense probably benign 0.00
R5115:Stk36 UTSW 1 74635827 missense probably damaging 1.00
R5266:Stk36 UTSW 1 74611158 missense probably benign
R5412:Stk36 UTSW 1 74605456 unclassified probably null
R5533:Stk36 UTSW 1 74626591 missense possibly damaging 0.65
R5782:Stk36 UTSW 1 74605425 missense possibly damaging 0.81
R6149:Stk36 UTSW 1 74634229 missense probably benign 0.00
R6208:Stk36 UTSW 1 74611432 missense probably benign 0.03
R6497:Stk36 UTSW 1 74603232 missense probably damaging 1.00
R6805:Stk36 UTSW 1 74622239 missense probably benign
R7064:Stk36 UTSW 1 74610820 missense probably damaging 1.00
R7102:Stk36 UTSW 1 74622223 missense probably benign 0.10
R7393:Stk36 UTSW 1 74611193 nonsense probably null
R7408:Stk36 UTSW 1 74633566 missense probably damaging 1.00
R7471:Stk36 UTSW 1 74634320 missense unknown
R7816:Stk36 UTSW 1 74611169 nonsense probably null
R8019:Stk36 UTSW 1 74612766 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAGAGGCAGCGTCTTAGAGCGAG -3'
(R):5'- TGAAACCAAATTGGAGCCCAAGAGC -3'

Sequencing Primer
(F):5'- AGAGCGAGTCTGTTTTCCTC -3'
(R):5'- GAGCCCAAGAGCAGATTCTTTC -3'
Posted On2013-04-24