Mutagenetix > Incidental Mutation

Incidental Mutation 'R0373:Nup188'

30576

Institutional Source

Beutler Lab

Gene Symbol

Nup188

Ensembl Gene

ENSMUSG00000052533

Gene Name

nucleoporin 188

Synonyms

MMRRC Submission

038579-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R0373 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30286397-30344266 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 30330988 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 997 (D997Y)

Ref Sequence

ENSEMBL: ENSMUSP00000065836 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064447]

AlphaFold

Q6ZQH8

Predicted Effect

probably damaging
Transcript: ENSMUST00000064447
AA Change: D997Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533
AA Change: D997Y

Domain	Start	End	E-Value	Type
Pfam:Nup188	31	941	9.3e-213	PFAM
low complexity region	1020	1035	N/A	INTRINSIC
low complexity region	1307	1320	N/A	INTRINSIC
low complexity region	1330	1360	N/A	INTRINSIC
low complexity region	1696	1709	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133603

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.8%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	A	T	3: 138,173,582	L235Q	probably damaging	Het
Adam6b	T	A	12: 113,490,655	V364D	probably benign	Het
Akap13	T	C	7: 75,609,929	L767P	probably benign	Het
Akap13	T	A	7: 75,730,500	S2193T	probably damaging	Het
Anapc11	T	C	11: 120,605,377	V69A	probably benign	Het
Ankmy1	C	T	1: 92,896,190	R118Q	probably damaging	Het
Ankrd27	T	C	7: 35,638,053	S931P	probably benign	Het
Atp6v1c2	G	A	12: 17,288,168	R280C	probably damaging	Het
Bbs10	T	A	10: 111,300,052	I342N	probably damaging	Het
Calhm2	T	C	19: 47,132,950	D260G	possibly damaging	Het
Camk2a	A	G	18: 60,958,238	E264G	probably damaging	Het
Ccdc146	T	A	5: 21,319,545	M270L	probably benign	Het
Cdc16	A	G	8: 13,779,264	T517A	probably benign	Het
Ces1g	T	C	8: 93,331,193	H160R	probably benign	Het
Chst4	T	C	8: 110,030,394	N196S	probably damaging	Het
Ciz1	A	T	2: 32,367,467	N175Y	probably damaging	Het
Cyb5r4	G	A	9: 87,027,040	V57I	probably damaging	Het
Cyth3	A	G	5: 143,684,426		probably benign	Het
Def6	A	G	17: 28,220,180	E255G	probably damaging	Het
Dhtkd1	T	G	2: 5,911,870	Q665P	probably damaging	Het
Dsg3	A	C	18: 20,539,747	D825A	probably damaging	Het
Eif3m	T	C	2: 105,005,000	T242A	probably benign	Het
Emilin3	A	G	2: 160,909,817	F101L	probably benign	Het
Epha7	A	G	4: 28,935,700		probably null	Het
Fam205a1	T	C	4: 42,851,161	I332V	probably benign	Het
Fbxo45	A	T	16: 32,238,405	Y224N	probably damaging	Het
Fhod3	A	T	18: 25,090,104	M836L	possibly damaging	Het
Fut4	C	A	9: 14,751,210	V263F	probably damaging	Het
Ggt1	C	T	10: 75,579,270	T206M	probably benign	Het
Gls	T	C	1: 52,188,699	R79G	probably damaging	Het
Gm436	A	T	4: 144,686,220	M50K	possibly damaging	Het
Grhl1	T	C	12: 24,581,515	S156P	probably benign	Het
Ipo8	C	T	6: 148,775,042	S983N	probably benign	Het
Kcna7	C	T	7: 45,409,444	A385V	probably damaging	Het
Kpnb1	A	T	11: 97,185,090	L40Q	probably damaging	Het
Matn1	A	T	4: 130,950,106	S209C	probably damaging	Het
Mcc	A	G	18: 44,475,222	I501T	probably benign	Het
Mdp1	A	T	14: 55,659,375	F104L	probably damaging	Het
Mib2	A	T	4: 155,656,288	N626K	probably damaging	Het
Mrgprh	T	C	17: 12,876,956	S28P	possibly damaging	Het
Mup-ps23	T	A	4: 61,856,149		noncoding transcript	Het
Myh15	A	G	16: 49,182,959	T1794A	possibly damaging	Het
Myo18a	C	G	11: 77,821,042	P680A	probably benign	Het
Myom2	G	T	8: 15,098,419	D532Y	possibly damaging	Het
Ndufaf5	A	G	2: 140,170,881	N57S	probably benign	Het
Nectin3	C	T	16: 46,458,187	V282M	probably damaging	Het
Olfm3	T	C	3: 115,122,805	V462A	probably damaging	Het
Olfr1044	A	C	2: 86,171,706	F37C	probably damaging	Het
Olfr1225	A	T	2: 89,170,413	F266L	probably benign	Het
Olfr305	A	T	7: 86,363,805	C177*	probably null	Het
Opcml	A	G	9: 28,813,398	H164R	possibly damaging	Het
Pacrg	A	G	17: 10,403,418	I209T	probably damaging	Het
Pcf11	T	C	7: 92,661,215	M522V	probably benign	Het
Pck1	T	A	2: 173,153,390	M1K	probably null	Het
Pcm1	G	T	8: 41,276,111	E707*	probably null	Het
Pcsk5	G	A	19: 17,654,849	R318W	probably damaging	Het
Phf11d	A	T	14: 59,353,344	M188K	possibly damaging	Het
Ppip5k2	A	T	1: 97,740,537	C615*	probably null	Het
Prkdc	T	A	16: 15,791,927	S3132T	probably damaging	Het
Prl2c5	A	T	13: 13,183,024		probably benign	Het
Prpsap2	A	G	11: 61,741,000	I177T	possibly damaging	Het
Rad50	A	G	11: 53,650,519	S1297P	probably damaging	Het
Rasip1	T	A	7: 45,635,244	N678K	possibly damaging	Het
Rubcn	A	G	16: 32,835,980	S544P	probably damaging	Het
Rwdd2a	A	T	9: 86,574,400	T210S	possibly damaging	Het
Scd2	A	G	19: 44,303,040	D306G	probably damaging	Het
Sema3b	T	C	9: 107,602,918	N207S	probably benign	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Sipa1l2	C	A	8: 125,464,410	C947F	probably damaging	Het
Slc12a1	A	T	2: 125,226,031	T1013S	probably damaging	Het
Slc18a2	A	T	19: 59,287,367	I461L	probably benign	Het
Slc1a6	C	A	10: 78,801,922	Y427*	probably null	Het
Slc30a4	A	T	2: 122,689,399	I231K	probably damaging	Het
Sos1	G	T	17: 80,453,763	A168D	probably damaging	Het
Sptb	T	C	12: 76,621,371	S651G	probably benign	Het
Stk36	T	C	1: 74,633,620	L1007P	probably damaging	Het
Tek	A	T	4: 94,804,341	N229Y	probably damaging	Het
Tep1	A	G	14: 50,836,768	F1887L	possibly damaging	Het
Tet1	A	T	10: 62,878,209	C602*	probably null	Het
Tnfrsf19	A	G	14: 60,972,036	S262P	possibly damaging	Het
Trim5	T	C	7: 104,265,684	I393V	probably benign	Het
Trpm6	A	G	19: 18,853,587	E1272G	probably benign	Het
Ttc21b	A	T	2: 66,188,326	Y1246N	probably damaging	Het
Ttll3	T	A	6: 113,398,777	L151H	probably damaging	Het
U2surp	C	T	9: 95,484,443	V470I	probably benign	Het
Ubr1	A	T	2: 120,946,657	Y276N	probably benign	Het
Uggt1	A	G	1: 36,179,670	S59P	probably benign	Het
Unc45a	T	C	7: 80,326,344	T796A	probably damaging	Het
Unc5b	C	A	10: 60,778,940	V193F	possibly damaging	Het
Upp1	G	T	11: 9,129,590	M50I	probably benign	Het
Vps18	C	T	2: 119,293,905	R438C	probably damaging	Het
Zfp715	T	C	7: 43,299,336	Y400C	possibly damaging	Het
Zfp955b	T	C	17: 33,302,522	Y322H	probably benign	Het

Other mutations in Nup188

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00908:Nup188	APN	2	30333400	missense	probably damaging	0.98
IGL01599:Nup188	APN	2	30327525	missense	possibly damaging	0.92
IGL01938:Nup188	APN	2	30329359	missense	probably benign
IGL01973:Nup188	APN	2	30339850	missense	possibly damaging	0.95
IGL02157:Nup188	APN	2	30329373	nonsense	probably null
IGL02221:Nup188	APN	2	30330641	missense	possibly damaging	0.75
IGL02277:Nup188	APN	2	30326511	missense	possibly damaging	0.95
IGL02335:Nup188	APN	2	30323636	critical splice donor site	probably null
IGL02986:Nup188	APN	2	30307633	splice site	probably null
IGL03029:Nup188	APN	2	30322580	splice site	probably benign
IGL03194:Nup188	APN	2	30304334	missense	possibly damaging	0.95
IGL03370:Nup188	APN	2	30340641	missense	possibly damaging	0.52
core	UTSW	2	30339894	missense	probably damaging	1.00
kern	UTSW	2	30337033	missense	possibly damaging	0.94
P0027:Nup188	UTSW	2	30322681	missense	probably damaging	0.99
R0006:Nup188	UTSW	2	30322023	missense	probably benign	0.27
R0360:Nup188	UTSW	2	30326479	missense	probably null	0.93
R0645:Nup188	UTSW	2	30343466	splice site	probably null
R1411:Nup188	UTSW	2	30343795	missense	probably benign	0.01
R1670:Nup188	UTSW	2	30340655	missense	probably benign	0.19
R2034:Nup188	UTSW	2	30310085	unclassified	probably benign
R2113:Nup188	UTSW	2	30304101	nonsense	probably null
R2142:Nup188	UTSW	2	30336706	missense	possibly damaging	0.49
R2221:Nup188	UTSW	2	30336924	splice site	probably benign
R2567:Nup188	UTSW	2	30341782	missense	possibly damaging	0.53
R2964:Nup188	UTSW	2	30325346	missense	probably damaging	0.98
R4006:Nup188	UTSW	2	30309878	missense	probably damaging	0.99
R4007:Nup188	UTSW	2	30309878	missense	probably damaging	0.99
R4079:Nup188	UTSW	2	30309878	missense	probably damaging	0.99
R4480:Nup188	UTSW	2	30322129	intron	probably benign
R4628:Nup188	UTSW	2	30329346	missense	probably damaging	1.00
R4687:Nup188	UTSW	2	30330633	missense	probably benign	0.01
R4814:Nup188	UTSW	2	30326511	missense	possibly damaging	0.95
R4834:Nup188	UTSW	2	30339584	missense	probably damaging	1.00
R5038:Nup188	UTSW	2	30309220	missense	probably damaging	0.98
R5056:Nup188	UTSW	2	30304131	missense	probably damaging	0.98
R5124:Nup188	UTSW	2	30330935	missense	probably damaging	1.00
R5256:Nup188	UTSW	2	30330749	missense	probably damaging	1.00
R5284:Nup188	UTSW	2	30330635	missense	probably damaging	1.00
R5548:Nup188	UTSW	2	30326493	missense	probably damaging	0.99
R5560:Nup188	UTSW	2	30309885	missense	probably damaging	0.99
R5668:Nup188	UTSW	2	30336324	missense	probably damaging	1.00
R5769:Nup188	UTSW	2	30330735	missense	probably benign	0.34
R5773:Nup188	UTSW	2	30322196	missense	possibly damaging	0.92
R5774:Nup188	UTSW	2	30301048	missense	probably damaging	1.00
R5827:Nup188	UTSW	2	30339847	missense	probably damaging	1.00
R5919:Nup188	UTSW	2	30339894	missense	probably damaging	1.00
R5923:Nup188	UTSW	2	30304090	missense	probably benign
R6185:Nup188	UTSW	2	30341710	missense	probably damaging	0.97
R6457:Nup188	UTSW	2	30322187	missense	probably damaging	0.98
R6529:Nup188	UTSW	2	30326454	missense	possibly damaging	0.95
R7002:Nup188	UTSW	2	30323568	missense	probably damaging	0.99
R7195:Nup188	UTSW	2	30341830	critical splice donor site	probably null
R7214:Nup188	UTSW	2	30307554	missense	possibly damaging	0.71
R7345:Nup188	UTSW	2	30340601	missense	probably benign	0.09
R7853:Nup188	UTSW	2	30323563	missense	possibly damaging	0.95
R7998:Nup188	UTSW	2	30330971	missense	probably damaging	1.00
R8012:Nup188	UTSW	2	30337265	missense	possibly damaging	0.95
R8080:Nup188	UTSW	2	30337033	missense	possibly damaging	0.94
R8804:Nup188	UTSW	2	30330879	missense	probably benign
R8850:Nup188	UTSW	2	30327564	missense	probably damaging	0.99
R9110:Nup188	UTSW	2	30332449	missense	possibly damaging	0.94
R9157:Nup188	UTSW	2	30298444	missense	probably benign	0.02
R9209:Nup188	UTSW	2	30342385	missense	probably benign	0.02
R9287:Nup188	UTSW	2	30336714	missense	probably damaging	0.99
R9325:Nup188	UTSW	2	30322259	missense	probably damaging	0.99
R9390:Nup188	UTSW	2	30330765	critical splice donor site	probably null
R9607:Nup188	UTSW	2	30307712	missense	probably benign	0.01
R9746:Nup188	UTSW	2	30304288	missense	probably damaging	0.99
R9768:Nup188	UTSW	2	30337033	missense	probably damaging	0.99
T0722:Nup188	UTSW	2	30322681	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGTCTCATCGAGCTGTTTCTGAATCTG -3'
(R):5'- GGTACTGAACTGCGTGCTAAGTATTCC -3'

Sequencing Primer
(F):5'- AGCAATGGCTCCAAGGTC -3'
(R):5'- TCCATGCATAATCTGGTAAACGC -3'

Posted On

2013-04-24