Incidental Mutation 'R0373:Vps18'
ID30583
Institutional Source Beutler Lab
Gene Symbol Vps18
Ensembl Gene ENSMUSG00000034216
Gene NameVPS18 CORVET/HOPS core subunit
Synonyms
MMRRC Submission 038579-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0373 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119288740-119298453 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119293905 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 438 (R438C)
Ref Sequence ENSEMBL: ENSMUSP00000036915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037280]
Predicted Effect probably damaging
Transcript: ENSMUST00000037280
AA Change: R438C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036915
Gene: ENSMUSG00000034216
AA Change: R438C

DomainStartEndE-ValueType
Pfam:Pep3_Vps18 291 435 2.4e-41 PFAM
low complexity region 486 500 N/A INTRINSIC
Pfam:Clathrin 619 771 5.9e-11 PFAM
coiled coil region 803 845 N/A INTRINSIC
Blast:RING 853 947 3e-47 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151500
Meta Mutation Damage Score 0.4596 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps18 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in the nervous system exhibit impaired neuron migration and neurodegeneration associated with increased apoptosis and impaired autophagy and endocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A T 3: 138,173,582 L235Q probably damaging Het
Adam6b T A 12: 113,490,655 V364D probably benign Het
Akap13 T C 7: 75,609,929 L767P probably benign Het
Akap13 T A 7: 75,730,500 S2193T probably damaging Het
Anapc11 T C 11: 120,605,377 V69A probably benign Het
Ankmy1 C T 1: 92,896,190 R118Q probably damaging Het
Ankrd27 T C 7: 35,638,053 S931P probably benign Het
Atp6v1c2 G A 12: 17,288,168 R280C probably damaging Het
Bbs10 T A 10: 111,300,052 I342N probably damaging Het
Calhm2 T C 19: 47,132,950 D260G possibly damaging Het
Camk2a A G 18: 60,958,238 E264G probably damaging Het
Ccdc146 T A 5: 21,319,545 M270L probably benign Het
Cdc16 A G 8: 13,779,264 T517A probably benign Het
Ces1g T C 8: 93,331,193 H160R probably benign Het
Chst4 T C 8: 110,030,394 N196S probably damaging Het
Ciz1 A T 2: 32,367,467 N175Y probably damaging Het
Cyb5r4 G A 9: 87,027,040 V57I probably damaging Het
Cyth3 A G 5: 143,684,426 probably benign Het
Def6 A G 17: 28,220,180 E255G probably damaging Het
Dhtkd1 T G 2: 5,911,870 Q665P probably damaging Het
Dsg3 A C 18: 20,539,747 D825A probably damaging Het
Eif3m T C 2: 105,005,000 T242A probably benign Het
Emilin3 A G 2: 160,909,817 F101L probably benign Het
Epha7 A G 4: 28,935,700 probably null Het
Fam205a1 T C 4: 42,851,161 I332V probably benign Het
Fbxo45 A T 16: 32,238,405 Y224N probably damaging Het
Fhod3 A T 18: 25,090,104 M836L possibly damaging Het
Fut4 C A 9: 14,751,210 V263F probably damaging Het
Ggt1 C T 10: 75,579,270 T206M probably benign Het
Gls T C 1: 52,188,699 R79G probably damaging Het
Gm436 A T 4: 144,686,220 M50K possibly damaging Het
Grhl1 T C 12: 24,581,515 S156P probably benign Het
Ipo8 C T 6: 148,775,042 S983N probably benign Het
Kcna7 C T 7: 45,409,444 A385V probably damaging Het
Kpnb1 A T 11: 97,185,090 L40Q probably damaging Het
Matn1 A T 4: 130,950,106 S209C probably damaging Het
Mcc A G 18: 44,475,222 I501T probably benign Het
Mdp1 A T 14: 55,659,375 F104L probably damaging Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Mrgprh T C 17: 12,876,956 S28P possibly damaging Het
Mup-ps23 T A 4: 61,856,149 noncoding transcript Het
Myh15 A G 16: 49,182,959 T1794A possibly damaging Het
Myo18a C G 11: 77,821,042 P680A probably benign Het
Myom2 G T 8: 15,098,419 D532Y possibly damaging Het
Ndufaf5 A G 2: 140,170,881 N57S probably benign Het
Nectin3 C T 16: 46,458,187 V282M probably damaging Het
Nup188 G T 2: 30,330,988 D997Y probably damaging Het
Olfm3 T C 3: 115,122,805 V462A probably damaging Het
Olfr1044 A C 2: 86,171,706 F37C probably damaging Het
Olfr1225 A T 2: 89,170,413 F266L probably benign Het
Olfr305 A T 7: 86,363,805 C177* probably null Het
Opcml A G 9: 28,813,398 H164R possibly damaging Het
Pacrg A G 17: 10,403,418 I209T probably damaging Het
Pcf11 T C 7: 92,661,215 M522V probably benign Het
Pck1 T A 2: 173,153,390 M1K probably null Het
Pcm1 G T 8: 41,276,111 E707* probably null Het
Pcsk5 G A 19: 17,654,849 R318W probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Ppip5k2 A T 1: 97,740,537 C615* probably null Het
Prkdc T A 16: 15,791,927 S3132T probably damaging Het
Prl2c5 A T 13: 13,183,024 probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rad50 A G 11: 53,650,519 S1297P probably damaging Het
Rasip1 T A 7: 45,635,244 N678K possibly damaging Het
Rubcn A G 16: 32,835,980 S544P probably damaging Het
Rwdd2a A T 9: 86,574,400 T210S possibly damaging Het
Scd2 A G 19: 44,303,040 D306G probably damaging Het
Sema3b T C 9: 107,602,918 N207S probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sipa1l2 C A 8: 125,464,410 C947F probably damaging Het
Slc12a1 A T 2: 125,226,031 T1013S probably damaging Het
Slc18a2 A T 19: 59,287,367 I461L probably benign Het
Slc1a6 C A 10: 78,801,922 Y427* probably null Het
Slc30a4 A T 2: 122,689,399 I231K probably damaging Het
Sos1 G T 17: 80,453,763 A168D probably damaging Het
Sptb T C 12: 76,621,371 S651G probably benign Het
Stk36 T C 1: 74,633,620 L1007P probably damaging Het
Tek A T 4: 94,804,341 N229Y probably damaging Het
Tep1 A G 14: 50,836,768 F1887L possibly damaging Het
Tet1 A T 10: 62,878,209 C602* probably null Het
Tnfrsf19 A G 14: 60,972,036 S262P possibly damaging Het
Trim5 T C 7: 104,265,684 I393V probably benign Het
Trpm6 A G 19: 18,853,587 E1272G probably benign Het
Ttc21b A T 2: 66,188,326 Y1246N probably damaging Het
Ttll3 T A 6: 113,398,777 L151H probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Ubr1 A T 2: 120,946,657 Y276N probably benign Het
Uggt1 A G 1: 36,179,670 S59P probably benign Het
Unc45a T C 7: 80,326,344 T796A probably damaging Het
Unc5b C A 10: 60,778,940 V193F possibly damaging Het
Upp1 G T 11: 9,129,590 M50I probably benign Het
Zfp715 T C 7: 43,299,336 Y400C possibly damaging Het
Zfp955b T C 17: 33,302,522 Y322H probably benign Het
Other mutations in Vps18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Vps18 APN 2 119297191 missense probably benign 0.03
IGL02311:Vps18 APN 2 119290251 missense probably benign 0.05
IGL02332:Vps18 APN 2 119293810 missense probably benign 0.04
IGL03089:Vps18 APN 2 119293177 missense probably benign 0.01
IGL03114:Vps18 APN 2 119293651 missense possibly damaging 0.55
IGL03334:Vps18 APN 2 119297482 missense probably damaging 1.00
F5770:Vps18 UTSW 2 119297228 missense probably benign 0.22
R0311:Vps18 UTSW 2 119297365 missense probably benign 0.05
R0346:Vps18 UTSW 2 119297164 missense probably damaging 1.00
R0637:Vps18 UTSW 2 119293905 missense probably damaging 0.99
R1493:Vps18 UTSW 2 119297132 missense probably damaging 1.00
R1703:Vps18 UTSW 2 119289057 missense probably benign 0.03
R1734:Vps18 UTSW 2 119293942 missense probably benign 0.01
R4297:Vps18 UTSW 2 119297331 nonsense probably null
R4633:Vps18 UTSW 2 119293276 missense probably damaging 1.00
R4729:Vps18 UTSW 2 119293791 missense probably damaging 1.00
R5034:Vps18 UTSW 2 119293306 missense probably benign 0.00
R5162:Vps18 UTSW 2 119292942 missense probably benign 0.19
R5320:Vps18 UTSW 2 119297377 nonsense probably null
R5857:Vps18 UTSW 2 119297533 missense probably damaging 1.00
R6105:Vps18 UTSW 2 119289062 missense probably damaging 1.00
R6150:Vps18 UTSW 2 119297592 nonsense probably null
R8018:Vps18 UTSW 2 119294011 missense probably damaging 1.00
RF002:Vps18 UTSW 2 119297390 missense probably damaging 1.00
V7583:Vps18 UTSW 2 119297228 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GAGAAGTTTGGACCACTGAGGCAC -3'
(R):5'- AGAGAGTCAGAGCATCTGGGTCAC -3'

Sequencing Primer
(F):5'- ACATGGTGAAGGACTCATCC -3'
(R):5'- AGCTCTGTCAGCCAAGTG -3'
Posted On2013-04-24