Incidental Mutation 'R0373:Matn1'
ID30597
Institutional Source Beutler Lab
Gene Symbol Matn1
Ensembl Gene ENSMUSG00000040533
Gene Namematrilin 1, cartilage matrix protein
SynonymsMat1, Crtm, CMP, matrilin-1
MMRRC Submission 038579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0373 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location130944385-130955475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130950106 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 209 (S209C)
Ref Sequence ENSEMBL: ENSMUSP00000099636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102576]
Predicted Effect probably damaging
Transcript: ENSMUST00000102576
AA Change: S209C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099636
Gene: ENSMUSG00000040533
AA Change: S209C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
VWA 43 225 5.5e-52 SMART
EGF 230 267 2.79e-4 SMART
VWA 277 456 1.76e-59 SMART
Matrilin_ccoil 454 500 1.8e-18 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. Mutations of this gene have been associated with variety of inherited chondrodysplasias. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are viable, fertile and display normal cartilage development and endochondral bone formation. Mice homozygous for one targeted allele show alterations in type II collagen fibrillogenesis and fibril organization, in the absence of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A T 3: 138,173,582 L235Q probably damaging Het
Adam6b T A 12: 113,490,655 V364D probably benign Het
Akap13 T C 7: 75,609,929 L767P probably benign Het
Akap13 T A 7: 75,730,500 S2193T probably damaging Het
Anapc11 T C 11: 120,605,377 V69A probably benign Het
Ankmy1 C T 1: 92,896,190 R118Q probably damaging Het
Ankrd27 T C 7: 35,638,053 S931P probably benign Het
Atp6v1c2 G A 12: 17,288,168 R280C probably damaging Het
Bbs10 T A 10: 111,300,052 I342N probably damaging Het
Calhm2 T C 19: 47,132,950 D260G possibly damaging Het
Camk2a A G 18: 60,958,238 E264G probably damaging Het
Ccdc146 T A 5: 21,319,545 M270L probably benign Het
Cdc16 A G 8: 13,779,264 T517A probably benign Het
Ces1g T C 8: 93,331,193 H160R probably benign Het
Chst4 T C 8: 110,030,394 N196S probably damaging Het
Ciz1 A T 2: 32,367,467 N175Y probably damaging Het
Cyb5r4 G A 9: 87,027,040 V57I probably damaging Het
Cyth3 A G 5: 143,684,426 probably benign Het
Def6 A G 17: 28,220,180 E255G probably damaging Het
Dhtkd1 T G 2: 5,911,870 Q665P probably damaging Het
Dsg3 A C 18: 20,539,747 D825A probably damaging Het
Eif3m T C 2: 105,005,000 T242A probably benign Het
Emilin3 A G 2: 160,909,817 F101L probably benign Het
Epha7 A G 4: 28,935,700 probably null Het
Fam205a1 T C 4: 42,851,161 I332V probably benign Het
Fbxo45 A T 16: 32,238,405 Y224N probably damaging Het
Fhod3 A T 18: 25,090,104 M836L possibly damaging Het
Fut4 C A 9: 14,751,210 V263F probably damaging Het
Ggt1 C T 10: 75,579,270 T206M probably benign Het
Gls T C 1: 52,188,699 R79G probably damaging Het
Gm436 A T 4: 144,686,220 M50K possibly damaging Het
Grhl1 T C 12: 24,581,515 S156P probably benign Het
Ipo8 C T 6: 148,775,042 S983N probably benign Het
Kcna7 C T 7: 45,409,444 A385V probably damaging Het
Kpnb1 A T 11: 97,185,090 L40Q probably damaging Het
Mcc A G 18: 44,475,222 I501T probably benign Het
Mdp1 A T 14: 55,659,375 F104L probably damaging Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Mrgprh T C 17: 12,876,956 S28P possibly damaging Het
Mup-ps23 T A 4: 61,856,149 noncoding transcript Het
Myh15 A G 16: 49,182,959 T1794A possibly damaging Het
Myo18a C G 11: 77,821,042 P680A probably benign Het
Myom2 G T 8: 15,098,419 D532Y possibly damaging Het
Ndufaf5 A G 2: 140,170,881 N57S probably benign Het
Nectin3 C T 16: 46,458,187 V282M probably damaging Het
Nup188 G T 2: 30,330,988 D997Y probably damaging Het
Olfm3 T C 3: 115,122,805 V462A probably damaging Het
Olfr1044 A C 2: 86,171,706 F37C probably damaging Het
Olfr1225 A T 2: 89,170,413 F266L probably benign Het
Olfr305 A T 7: 86,363,805 C177* probably null Het
Opcml A G 9: 28,813,398 H164R possibly damaging Het
Pacrg A G 17: 10,403,418 I209T probably damaging Het
Pcf11 T C 7: 92,661,215 M522V probably benign Het
Pck1 T A 2: 173,153,390 M1K probably null Het
Pcm1 G T 8: 41,276,111 E707* probably null Het
Pcsk5 G A 19: 17,654,849 R318W probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Ppip5k2 A T 1: 97,740,537 C615* probably null Het
Prkdc T A 16: 15,791,927 S3132T probably damaging Het
Prl2c5 A T 13: 13,183,024 probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rad50 A G 11: 53,650,519 S1297P probably damaging Het
Rasip1 T A 7: 45,635,244 N678K possibly damaging Het
Rubcn A G 16: 32,835,980 S544P probably damaging Het
Rwdd2a A T 9: 86,574,400 T210S possibly damaging Het
Scd2 A G 19: 44,303,040 D306G probably damaging Het
Sema3b T C 9: 107,602,918 N207S probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sipa1l2 C A 8: 125,464,410 C947F probably damaging Het
Slc12a1 A T 2: 125,226,031 T1013S probably damaging Het
Slc18a2 A T 19: 59,287,367 I461L probably benign Het
Slc1a6 C A 10: 78,801,922 Y427* probably null Het
Slc30a4 A T 2: 122,689,399 I231K probably damaging Het
Sos1 G T 17: 80,453,763 A168D probably damaging Het
Sptb T C 12: 76,621,371 S651G probably benign Het
Stk36 T C 1: 74,633,620 L1007P probably damaging Het
Tek A T 4: 94,804,341 N229Y probably damaging Het
Tep1 A G 14: 50,836,768 F1887L possibly damaging Het
Tet1 A T 10: 62,878,209 C602* probably null Het
Tnfrsf19 A G 14: 60,972,036 S262P possibly damaging Het
Trim5 T C 7: 104,265,684 I393V probably benign Het
Trpm6 A G 19: 18,853,587 E1272G probably benign Het
Ttc21b A T 2: 66,188,326 Y1246N probably damaging Het
Ttll3 T A 6: 113,398,777 L151H probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Ubr1 A T 2: 120,946,657 Y276N probably benign Het
Uggt1 A G 1: 36,179,670 S59P probably benign Het
Unc45a T C 7: 80,326,344 T796A probably damaging Het
Unc5b C A 10: 60,778,940 V193F possibly damaging Het
Upp1 G T 11: 9,129,590 M50I probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp715 T C 7: 43,299,336 Y400C possibly damaging Het
Zfp955b T C 17: 33,302,522 Y322H probably benign Het
Other mutations in Matn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Matn1 APN 4 130952974 missense probably benign
IGL01084:Matn1 APN 4 130951934 missense probably benign 0.13
IGL01123:Matn1 APN 4 130950011 missense possibly damaging 0.72
IGL01941:Matn1 APN 4 130952261 splice site probably benign
IGL02289:Matn1 APN 4 130951835 splice site probably benign
IGL02297:Matn1 APN 4 130952264 splice site probably benign
IGL02488:Matn1 APN 4 130944493 missense probably benign 0.20
IGL03493:Matn1 APN 4 130949998 missense probably benign 0.37
R0282:Matn1 UTSW 4 130945927 missense probably damaging 0.98
R0384:Matn1 UTSW 4 130944476 missense probably benign 0.20
R1457:Matn1 UTSW 4 130950019 missense possibly damaging 0.89
R3955:Matn1 UTSW 4 130951415 critical splice donor site probably null
R4014:Matn1 UTSW 4 130951947 missense possibly damaging 0.69
R4801:Matn1 UTSW 4 130950025 missense possibly damaging 0.82
R4802:Matn1 UTSW 4 130950025 missense possibly damaging 0.82
R4887:Matn1 UTSW 4 130952114 missense probably benign 0.13
R4961:Matn1 UTSW 4 130952923 missense probably damaging 1.00
R6062:Matn1 UTSW 4 130951966 missense probably benign 0.03
R7868:Matn1 UTSW 4 130955000 missense probably damaging 1.00
R7951:Matn1 UTSW 4 130955000 missense probably damaging 1.00
Z1176:Matn1 UTSW 4 130946105 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCAGAAGAAGCCGATAGTCTCCC -3'
(R):5'- CCAACTAGGCTCTGAGATTGGTGC -3'

Sequencing Primer
(F):5'- gtgtgtgtgtgtgtTCTGGC -3'
(R):5'- GGTGCCACAGATTCTCAGAATTAG -3'
Posted On2013-04-24