Incidental Mutation 'R0373:Cyth3'
ID 30601
Institutional Source Beutler Lab
Gene Symbol Cyth3
Ensembl Gene ENSMUSG00000018001
Gene Name cytohesin 3
Synonyms Grp1, Pscd3, cytohesin 3
MMRRC Submission 038579-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock # R0373 (G1)
Quality Score 181
Status Not validated
Chromosome 5
Chromosomal Location 143622447-143710250 bp(+) (GRCm38)
Type of Mutation utr 5 prime
DNA Base Change (assembly) A to G at 143684426 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110727] [ENSMUST00000116456] [ENSMUST00000131436] [ENSMUST00000177196] [ENSMUST00000177281]
AlphaFold O08967
Predicted Effect probably benign
Transcript: ENSMUST00000110727
SMART Domains Protein: ENSMUSP00000106355
Gene: ENSMUSG00000018001

DomainStartEndE-ValueType
Sec7 15 200 1.5e-106 SMART
PH 217 334 1.1e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000116456
AA Change: E22G
SMART Domains Protein: ENSMUSP00000112157
Gene: ENSMUSG00000018001
AA Change: E22G

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
low complexity region 14 35 N/A INTRINSIC
Sec7 63 248 3.21e-104 SMART
PH 265 382 2.36e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131436
SMART Domains Protein: ENSMUSP00000118290
Gene: ENSMUSG00000018001

DomainStartEndE-ValueType
Pfam:Sec7 13 70 5.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177196
Predicted Effect unknown
Transcript: ENSMUST00000177281
AA Change: E30G
SMART Domains Protein: ENSMUSP00000135287
Gene: ENSMUSG00000018001
AA Change: E30G

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Blast:Sec7 45 91 1e-11 BLAST
PDB:1S9D|E 63 93 4e-8 PDB
SCOP:d1pbv__ 65 93 7e-8 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PSCD (pleckstrin homology, Sec7 and coiled-coil domains) family. PSCD family members have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This encoded protein is involved in the control of Golgi structure and function, and it may have a physiological role in regulating ADP-ribosylation factor protein 6 (ARF) functions, in addition to acting on ARF1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A T 3: 138,173,582 L235Q probably damaging Het
Adam6b T A 12: 113,490,655 V364D probably benign Het
Akap13 T C 7: 75,609,929 L767P probably benign Het
Akap13 T A 7: 75,730,500 S2193T probably damaging Het
Anapc11 T C 11: 120,605,377 V69A probably benign Het
Ankmy1 C T 1: 92,896,190 R118Q probably damaging Het
Ankrd27 T C 7: 35,638,053 S931P probably benign Het
Atp6v1c2 G A 12: 17,288,168 R280C probably damaging Het
Bbs10 T A 10: 111,300,052 I342N probably damaging Het
Calhm2 T C 19: 47,132,950 D260G possibly damaging Het
Camk2a A G 18: 60,958,238 E264G probably damaging Het
Ccdc146 T A 5: 21,319,545 M270L probably benign Het
Cdc16 A G 8: 13,779,264 T517A probably benign Het
Ces1g T C 8: 93,331,193 H160R probably benign Het
Chst4 T C 8: 110,030,394 N196S probably damaging Het
Ciz1 A T 2: 32,367,467 N175Y probably damaging Het
Cyb5r4 G A 9: 87,027,040 V57I probably damaging Het
Def6 A G 17: 28,220,180 E255G probably damaging Het
Dhtkd1 T G 2: 5,911,870 Q665P probably damaging Het
Dsg3 A C 18: 20,539,747 D825A probably damaging Het
Eif3m T C 2: 105,005,000 T242A probably benign Het
Emilin3 A G 2: 160,909,817 F101L probably benign Het
Epha7 A G 4: 28,935,700 probably null Het
Fam205a1 T C 4: 42,851,161 I332V probably benign Het
Fbxo45 A T 16: 32,238,405 Y224N probably damaging Het
Fhod3 A T 18: 25,090,104 M836L possibly damaging Het
Fut4 C A 9: 14,751,210 V263F probably damaging Het
Ggt1 C T 10: 75,579,270 T206M probably benign Het
Gls T C 1: 52,188,699 R79G probably damaging Het
Gm436 A T 4: 144,686,220 M50K possibly damaging Het
Grhl1 T C 12: 24,581,515 S156P probably benign Het
Ipo8 C T 6: 148,775,042 S983N probably benign Het
Kcna7 C T 7: 45,409,444 A385V probably damaging Het
Kpnb1 A T 11: 97,185,090 L40Q probably damaging Het
Matn1 A T 4: 130,950,106 S209C probably damaging Het
Mcc A G 18: 44,475,222 I501T probably benign Het
Mdp1 A T 14: 55,659,375 F104L probably damaging Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Mrgprh T C 17: 12,876,956 S28P possibly damaging Het
Mup-ps23 T A 4: 61,856,149 noncoding transcript Het
Myh15 A G 16: 49,182,959 T1794A possibly damaging Het
Myo18a C G 11: 77,821,042 P680A probably benign Het
Myom2 G T 8: 15,098,419 D532Y possibly damaging Het
Ndufaf5 A G 2: 140,170,881 N57S probably benign Het
Nectin3 C T 16: 46,458,187 V282M probably damaging Het
Nup188 G T 2: 30,330,988 D997Y probably damaging Het
Olfm3 T C 3: 115,122,805 V462A probably damaging Het
Olfr1044 A C 2: 86,171,706 F37C probably damaging Het
Olfr1225 A T 2: 89,170,413 F266L probably benign Het
Olfr305 A T 7: 86,363,805 C177* probably null Het
Opcml A G 9: 28,813,398 H164R possibly damaging Het
Pacrg A G 17: 10,403,418 I209T probably damaging Het
Pcf11 T C 7: 92,661,215 M522V probably benign Het
Pck1 T A 2: 173,153,390 M1K probably null Het
Pcm1 G T 8: 41,276,111 E707* probably null Het
Pcsk5 G A 19: 17,654,849 R318W probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Ppip5k2 A T 1: 97,740,537 C615* probably null Het
Prkdc T A 16: 15,791,927 S3132T probably damaging Het
Prl2c5 A T 13: 13,183,024 probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rad50 A G 11: 53,650,519 S1297P probably damaging Het
Rasip1 T A 7: 45,635,244 N678K possibly damaging Het
Rubcn A G 16: 32,835,980 S544P probably damaging Het
Rwdd2a A T 9: 86,574,400 T210S possibly damaging Het
Scd2 A G 19: 44,303,040 D306G probably damaging Het
Sema3b T C 9: 107,602,918 N207S probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sipa1l2 C A 8: 125,464,410 C947F probably damaging Het
Slc12a1 A T 2: 125,226,031 T1013S probably damaging Het
Slc18a2 A T 19: 59,287,367 I461L probably benign Het
Slc1a6 C A 10: 78,801,922 Y427* probably null Het
Slc30a4 A T 2: 122,689,399 I231K probably damaging Het
Sos1 G T 17: 80,453,763 A168D probably damaging Het
Sptb T C 12: 76,621,371 S651G probably benign Het
Stk36 T C 1: 74,633,620 L1007P probably damaging Het
Tek A T 4: 94,804,341 N229Y probably damaging Het
Tep1 A G 14: 50,836,768 F1887L possibly damaging Het
Tet1 A T 10: 62,878,209 C602* probably null Het
Tnfrsf19 A G 14: 60,972,036 S262P possibly damaging Het
Trim5 T C 7: 104,265,684 I393V probably benign Het
Trpm6 A G 19: 18,853,587 E1272G probably benign Het
Ttc21b A T 2: 66,188,326 Y1246N probably damaging Het
Ttll3 T A 6: 113,398,777 L151H probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Ubr1 A T 2: 120,946,657 Y276N probably benign Het
Uggt1 A G 1: 36,179,670 S59P probably benign Het
Unc45a T C 7: 80,326,344 T796A probably damaging Het
Unc5b C A 10: 60,778,940 V193F possibly damaging Het
Upp1 G T 11: 9,129,590 M50I probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp715 T C 7: 43,299,336 Y400C possibly damaging Het
Zfp955b T C 17: 33,302,522 Y322H probably benign Het
Other mutations in Cyth3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cyth3 APN 5 143707165 splice site probably null
IGL01340:Cyth3 APN 5 143684435 nonsense probably null
IGL01372:Cyth3 APN 5 143692638 missense possibly damaging 0.93
IGL02092:Cyth3 APN 5 143707385 splice site probably benign
IGL02850:Cyth3 APN 5 143686504 missense probably damaging 0.97
IGL02892:Cyth3 APN 5 143707437 missense possibly damaging 0.86
R0726:Cyth3 UTSW 5 143692642 missense probably benign 0.00
R1217:Cyth3 UTSW 5 143702820 missense probably damaging 1.00
R1552:Cyth3 UTSW 5 143697750 missense probably benign 0.12
R1623:Cyth3 UTSW 5 143701372 missense probably damaging 1.00
R1873:Cyth3 UTSW 5 143697761 missense possibly damaging 0.54
R3788:Cyth3 UTSW 5 143636543 intron probably benign
R4736:Cyth3 UTSW 5 143684479 critical splice donor site probably null
R6500:Cyth3 UTSW 5 143707840 missense probably damaging 0.97
R6824:Cyth3 UTSW 5 143686510 missense probably damaging 1.00
R7105:Cyth3 UTSW 5 143707272 missense probably benign 0.07
R7143:Cyth3 UTSW 5 143684396 missense unknown
R7767:Cyth3 UTSW 5 143707474 missense probably damaging 1.00
R7839:Cyth3 UTSW 5 143697754 missense probably benign 0.01
R8220:Cyth3 UTSW 5 143701589 splice site probably null
R8497:Cyth3 UTSW 5 143692573 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCTACATGCAGTTGAGAGCTGAG -3'
(R):5'- ACTGGGAATGTTAGTCCCATCGAGG -3'

Sequencing Primer
(F):5'- TCTTAGCACTACAGCCTGTAAGAG -3'
(R):5'- AGTCTGGAGAAGCCATCTCCTC -3'
Posted On 2013-04-24