Incidental Mutation 'R0373:Ipo8'
ID 30603
Institutional Source Beutler Lab
Gene Symbol Ipo8
Ensembl Gene ENSMUSG00000040029
Gene Name importin 8
Synonyms OM-1, Om1, C130009K11Rik, Ranbp8, 6230418K12Rik
MMRRC Submission 038579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0373 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 148770683-148831467 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 148775042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 983 (S983N)
Ref Sequence ENSEMBL: ENSMUSP00000046759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048418]
AlphaFold Q7TMY7
Predicted Effect probably benign
Transcript: ENSMUST00000048418
AA Change: S983N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046759
Gene: ENSMUSG00000040029
AA Change: S983N

DomainStartEndE-ValueType
IBN_N 22 102 1.59e-13 SMART
Pfam:Cse1 166 470 6.6e-11 PFAM
low complexity region 895 908 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204424
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. This protein binds to the nuclear pore complex and, along with RanGTP and RANBP1, inhibits the GAP stimulation of the Ran GTPase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A T 3: 138,173,582 L235Q probably damaging Het
Adam6b T A 12: 113,490,655 V364D probably benign Het
Akap13 T C 7: 75,609,929 L767P probably benign Het
Akap13 T A 7: 75,730,500 S2193T probably damaging Het
Anapc11 T C 11: 120,605,377 V69A probably benign Het
Ankmy1 C T 1: 92,896,190 R118Q probably damaging Het
Ankrd27 T C 7: 35,638,053 S931P probably benign Het
Atp6v1c2 G A 12: 17,288,168 R280C probably damaging Het
Bbs10 T A 10: 111,300,052 I342N probably damaging Het
Calhm2 T C 19: 47,132,950 D260G possibly damaging Het
Camk2a A G 18: 60,958,238 E264G probably damaging Het
Ccdc146 T A 5: 21,319,545 M270L probably benign Het
Cdc16 A G 8: 13,779,264 T517A probably benign Het
Ces1g T C 8: 93,331,193 H160R probably benign Het
Chst4 T C 8: 110,030,394 N196S probably damaging Het
Ciz1 A T 2: 32,367,467 N175Y probably damaging Het
Cyb5r4 G A 9: 87,027,040 V57I probably damaging Het
Cyth3 A G 5: 143,684,426 probably benign Het
Def6 A G 17: 28,220,180 E255G probably damaging Het
Dhtkd1 T G 2: 5,911,870 Q665P probably damaging Het
Dsg3 A C 18: 20,539,747 D825A probably damaging Het
Eif3m T C 2: 105,005,000 T242A probably benign Het
Emilin3 A G 2: 160,909,817 F101L probably benign Het
Epha7 A G 4: 28,935,700 probably null Het
Fam205a1 T C 4: 42,851,161 I332V probably benign Het
Fbxo45 A T 16: 32,238,405 Y224N probably damaging Het
Fhod3 A T 18: 25,090,104 M836L possibly damaging Het
Fut4 C A 9: 14,751,210 V263F probably damaging Het
Ggt1 C T 10: 75,579,270 T206M probably benign Het
Gls T C 1: 52,188,699 R79G probably damaging Het
Gm436 A T 4: 144,686,220 M50K possibly damaging Het
Grhl1 T C 12: 24,581,515 S156P probably benign Het
Kcna7 C T 7: 45,409,444 A385V probably damaging Het
Kpnb1 A T 11: 97,185,090 L40Q probably damaging Het
Matn1 A T 4: 130,950,106 S209C probably damaging Het
Mcc A G 18: 44,475,222 I501T probably benign Het
Mdp1 A T 14: 55,659,375 F104L probably damaging Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Mrgprh T C 17: 12,876,956 S28P possibly damaging Het
Mup-ps23 T A 4: 61,856,149 noncoding transcript Het
Myh15 A G 16: 49,182,959 T1794A possibly damaging Het
Myo18a C G 11: 77,821,042 P680A probably benign Het
Myom2 G T 8: 15,098,419 D532Y possibly damaging Het
Ndufaf5 A G 2: 140,170,881 N57S probably benign Het
Nectin3 C T 16: 46,458,187 V282M probably damaging Het
Nup188 G T 2: 30,330,988 D997Y probably damaging Het
Olfm3 T C 3: 115,122,805 V462A probably damaging Het
Olfr1044 A C 2: 86,171,706 F37C probably damaging Het
Olfr1225 A T 2: 89,170,413 F266L probably benign Het
Olfr305 A T 7: 86,363,805 C177* probably null Het
Opcml A G 9: 28,813,398 H164R possibly damaging Het
Pacrg A G 17: 10,403,418 I209T probably damaging Het
Pcf11 T C 7: 92,661,215 M522V probably benign Het
Pck1 T A 2: 173,153,390 M1K probably null Het
Pcm1 G T 8: 41,276,111 E707* probably null Het
Pcsk5 G A 19: 17,654,849 R318W probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Ppip5k2 A T 1: 97,740,537 C615* probably null Het
Prkdc T A 16: 15,791,927 S3132T probably damaging Het
Prl2c5 A T 13: 13,183,024 probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rad50 A G 11: 53,650,519 S1297P probably damaging Het
Rasip1 T A 7: 45,635,244 N678K possibly damaging Het
Rubcn A G 16: 32,835,980 S544P probably damaging Het
Rwdd2a A T 9: 86,574,400 T210S possibly damaging Het
Scd2 A G 19: 44,303,040 D306G probably damaging Het
Sema3b T C 9: 107,602,918 N207S probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sipa1l2 C A 8: 125,464,410 C947F probably damaging Het
Slc12a1 A T 2: 125,226,031 T1013S probably damaging Het
Slc18a2 A T 19: 59,287,367 I461L probably benign Het
Slc1a6 C A 10: 78,801,922 Y427* probably null Het
Slc30a4 A T 2: 122,689,399 I231K probably damaging Het
Sos1 G T 17: 80,453,763 A168D probably damaging Het
Sptb T C 12: 76,621,371 S651G probably benign Het
Stk36 T C 1: 74,633,620 L1007P probably damaging Het
Tek A T 4: 94,804,341 N229Y probably damaging Het
Tep1 A G 14: 50,836,768 F1887L possibly damaging Het
Tet1 A T 10: 62,878,209 C602* probably null Het
Tnfrsf19 A G 14: 60,972,036 S262P possibly damaging Het
Trim5 T C 7: 104,265,684 I393V probably benign Het
Trpm6 A G 19: 18,853,587 E1272G probably benign Het
Ttc21b A T 2: 66,188,326 Y1246N probably damaging Het
Ttll3 T A 6: 113,398,777 L151H probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Ubr1 A T 2: 120,946,657 Y276N probably benign Het
Uggt1 A G 1: 36,179,670 S59P probably benign Het
Unc45a T C 7: 80,326,344 T796A probably damaging Het
Unc5b C A 10: 60,778,940 V193F possibly damaging Het
Upp1 G T 11: 9,129,590 M50I probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp715 T C 7: 43,299,336 Y400C possibly damaging Het
Zfp955b T C 17: 33,302,522 Y322H probably benign Het
Other mutations in Ipo8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ipo8 APN 6 148782786 missense possibly damaging 0.77
IGL01012:Ipo8 APN 6 148789063 splice site probably benign
IGL01124:Ipo8 APN 6 148777376 missense probably benign
IGL01978:Ipo8 APN 6 148777289 missense probably benign 0.25
IGL02111:Ipo8 APN 6 148799780 missense probably damaging 1.00
IGL02193:Ipo8 APN 6 148777284 missense probably damaging 0.96
IGL02589:Ipo8 APN 6 148809907 missense probably damaging 0.98
IGL02690:Ipo8 APN 6 148777363 missense probably benign
IGL02724:Ipo8 APN 6 148791481 nonsense probably null
IGL02935:Ipo8 APN 6 148789841 missense probably benign 0.03
IGL03027:Ipo8 APN 6 148777239 missense probably benign 0.01
IGL03065:Ipo8 APN 6 148784707 missense probably benign 0.44
IGL03338:Ipo8 APN 6 148800257 missense probably benign 0.01
important UTSW 6 148816497 nonsense probably null
R0032:Ipo8 UTSW 6 148810711 missense probably damaging 0.99
R0032:Ipo8 UTSW 6 148810711 missense probably damaging 0.99
R0088:Ipo8 UTSW 6 148801936 missense probably benign 0.27
R0539:Ipo8 UTSW 6 148818108 missense probably benign 0.00
R0565:Ipo8 UTSW 6 148786723 missense probably damaging 1.00
R0660:Ipo8 UTSW 6 148800213 missense probably benign 0.02
R0664:Ipo8 UTSW 6 148800213 missense probably benign 0.02
R0791:Ipo8 UTSW 6 148821727 missense possibly damaging 0.94
R0989:Ipo8 UTSW 6 148796682 missense probably benign 0.38
R1416:Ipo8 UTSW 6 148789093 missense probably benign
R1417:Ipo8 UTSW 6 148818052 missense probably benign 0.02
R1590:Ipo8 UTSW 6 148810665 splice site probably null
R1703:Ipo8 UTSW 6 148789892 missense probably benign 0.00
R1709:Ipo8 UTSW 6 148782728 missense probably benign
R2079:Ipo8 UTSW 6 148789162 missense probably damaging 1.00
R2338:Ipo8 UTSW 6 148789823 missense probably benign 0.00
R2359:Ipo8 UTSW 6 148816477 splice site probably benign
R2696:Ipo8 UTSW 6 148796741 missense probably benign 0.01
R3407:Ipo8 UTSW 6 148821709 missense probably benign 0.03
R3408:Ipo8 UTSW 6 148821709 missense probably benign 0.03
R3709:Ipo8 UTSW 6 148806344 splice site probably null
R3710:Ipo8 UTSW 6 148806344 splice site probably null
R3945:Ipo8 UTSW 6 148818117 missense probably damaging 1.00
R4326:Ipo8 UTSW 6 148800164 unclassified probably benign
R4329:Ipo8 UTSW 6 148800164 unclassified probably benign
R6105:Ipo8 UTSW 6 148798670 missense probably damaging 1.00
R6148:Ipo8 UTSW 6 148799780 missense probably damaging 1.00
R6359:Ipo8 UTSW 6 148777250 missense probably benign 0.01
R6377:Ipo8 UTSW 6 148816497 nonsense probably null
R6724:Ipo8 UTSW 6 148809975 splice site probably null
R7283:Ipo8 UTSW 6 148824481 missense possibly damaging 0.86
R7436:Ipo8 UTSW 6 148789805 missense probably benign 0.13
R7445:Ipo8 UTSW 6 148789817 missense probably benign 0.09
R8044:Ipo8 UTSW 6 148809923 missense probably damaging 1.00
R8209:Ipo8 UTSW 6 148796678 missense possibly damaging 0.93
R8812:Ipo8 UTSW 6 148775077 missense possibly damaging 0.64
R8943:Ipo8 UTSW 6 148775049 missense probably benign 0.00
R9067:Ipo8 UTSW 6 148777232 missense probably damaging 1.00
R9129:Ipo8 UTSW 6 148798627 missense probably benign 0.05
R9297:Ipo8 UTSW 6 148801578 missense possibly damaging 0.63
R9419:Ipo8 UTSW 6 148784566 missense probably benign 0.15
Z1177:Ipo8 UTSW 6 148796712 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCAGCTATATGACAGTGGAACTC -3'
(R):5'- GGTATCAAGTAGGCCCTCGGAAATG -3'

Sequencing Primer
(F):5'- CTTCATTATCATGAAGGGCTCATTTC -3'
(R):5'- AATGACTGTTGGGATCAGACTC -3'
Posted On 2013-04-24