Incidental Mutation 'R0373:Akap13'
ID30609
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene NameA kinase (PRKA) anchor protein 13
SynonymsAKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
MMRRC Submission 038579-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0373 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location75455534-75754609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75609929 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 767 (L767P)
Ref Sequence ENSEMBL: ENSMUSP00000147237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]
Predicted Effect probably benign
Transcript: ENSMUST00000147005
AA Change: L767P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: L767P

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
internal_repeat_1 485 695 4.85e-5 PROSPERO
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
Pfam:RII_binding_1 1218 1235 4.3e-6 PFAM
low complexity region 1429 1444 N/A INTRINSIC
low complexity region 1479 1501 N/A INTRINSIC
low complexity region 1601 1612 N/A INTRINSIC
low complexity region 1738 1768 N/A INTRINSIC
C1 1773 1819 1.95e-4 SMART
low complexity region 1876 1887 N/A INTRINSIC
RhoGEF 1979 2171 1.28e-61 SMART
PH 2213 2316 2.94e-11 SMART
coiled coil region 2326 2363 N/A INTRINSIC
low complexity region 2411 2430 N/A INTRINSIC
low complexity region 2462 2472 N/A INTRINSIC
coiled coil region 2551 2664 N/A INTRINSIC
low complexity region 2746 2752 N/A INTRINSIC
low complexity region 2758 2771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166315
AA Change: L767P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: L767P

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207079
Predicted Effect probably benign
Transcript: ENSMUST00000207750
AA Change: L767P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000207923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208456
Predicted Effect probably benign
Transcript: ENSMUST00000208708
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A T 3: 138,173,582 L235Q probably damaging Het
Adam6b T A 12: 113,490,655 V364D probably benign Het
Anapc11 T C 11: 120,605,377 V69A probably benign Het
Ankmy1 C T 1: 92,896,190 R118Q probably damaging Het
Ankrd27 T C 7: 35,638,053 S931P probably benign Het
Atp6v1c2 G A 12: 17,288,168 R280C probably damaging Het
Bbs10 T A 10: 111,300,052 I342N probably damaging Het
Calhm2 T C 19: 47,132,950 D260G possibly damaging Het
Camk2a A G 18: 60,958,238 E264G probably damaging Het
Ccdc146 T A 5: 21,319,545 M270L probably benign Het
Cdc16 A G 8: 13,779,264 T517A probably benign Het
Ces1g T C 8: 93,331,193 H160R probably benign Het
Chst4 T C 8: 110,030,394 N196S probably damaging Het
Ciz1 A T 2: 32,367,467 N175Y probably damaging Het
Cyb5r4 G A 9: 87,027,040 V57I probably damaging Het
Cyth3 A G 5: 143,684,426 probably benign Het
Def6 A G 17: 28,220,180 E255G probably damaging Het
Dhtkd1 T G 2: 5,911,870 Q665P probably damaging Het
Dsg3 A C 18: 20,539,747 D825A probably damaging Het
Eif3m T C 2: 105,005,000 T242A probably benign Het
Emilin3 A G 2: 160,909,817 F101L probably benign Het
Epha7 A G 4: 28,935,700 probably null Het
Fam205a1 T C 4: 42,851,161 I332V probably benign Het
Fbxo45 A T 16: 32,238,405 Y224N probably damaging Het
Fhod3 A T 18: 25,090,104 M836L possibly damaging Het
Fut4 C A 9: 14,751,210 V263F probably damaging Het
Ggt1 C T 10: 75,579,270 T206M probably benign Het
Gls T C 1: 52,188,699 R79G probably damaging Het
Gm436 A T 4: 144,686,220 M50K possibly damaging Het
Grhl1 T C 12: 24,581,515 S156P probably benign Het
Ipo8 C T 6: 148,775,042 S983N probably benign Het
Kcna7 C T 7: 45,409,444 A385V probably damaging Het
Kpnb1 A T 11: 97,185,090 L40Q probably damaging Het
Matn1 A T 4: 130,950,106 S209C probably damaging Het
Mcc A G 18: 44,475,222 I501T probably benign Het
Mdp1 A T 14: 55,659,375 F104L probably damaging Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Mrgprh T C 17: 12,876,956 S28P possibly damaging Het
Mup-ps23 T A 4: 61,856,149 noncoding transcript Het
Myh15 A G 16: 49,182,959 T1794A possibly damaging Het
Myo18a C G 11: 77,821,042 P680A probably benign Het
Myom2 G T 8: 15,098,419 D532Y possibly damaging Het
Ndufaf5 A G 2: 140,170,881 N57S probably benign Het
Nectin3 C T 16: 46,458,187 V282M probably damaging Het
Nup188 G T 2: 30,330,988 D997Y probably damaging Het
Olfm3 T C 3: 115,122,805 V462A probably damaging Het
Olfr1044 A C 2: 86,171,706 F37C probably damaging Het
Olfr1225 A T 2: 89,170,413 F266L probably benign Het
Olfr305 A T 7: 86,363,805 C177* probably null Het
Opcml A G 9: 28,813,398 H164R possibly damaging Het
Pacrg A G 17: 10,403,418 I209T probably damaging Het
Pcf11 T C 7: 92,661,215 M522V probably benign Het
Pck1 T A 2: 173,153,390 M1K probably null Het
Pcm1 G T 8: 41,276,111 E707* probably null Het
Pcsk5 G A 19: 17,654,849 R318W probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Ppip5k2 A T 1: 97,740,537 C615* probably null Het
Prkdc T A 16: 15,791,927 S3132T probably damaging Het
Prl2c5 A T 13: 13,183,024 probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rad50 A G 11: 53,650,519 S1297P probably damaging Het
Rasip1 T A 7: 45,635,244 N678K possibly damaging Het
Rubcn A G 16: 32,835,980 S544P probably damaging Het
Rwdd2a A T 9: 86,574,400 T210S possibly damaging Het
Scd2 A G 19: 44,303,040 D306G probably damaging Het
Sema3b T C 9: 107,602,918 N207S probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sipa1l2 C A 8: 125,464,410 C947F probably damaging Het
Slc12a1 A T 2: 125,226,031 T1013S probably damaging Het
Slc18a2 A T 19: 59,287,367 I461L probably benign Het
Slc1a6 C A 10: 78,801,922 Y427* probably null Het
Slc30a4 A T 2: 122,689,399 I231K probably damaging Het
Sos1 G T 17: 80,453,763 A168D probably damaging Het
Sptb T C 12: 76,621,371 S651G probably benign Het
Stk36 T C 1: 74,633,620 L1007P probably damaging Het
Tek A T 4: 94,804,341 N229Y probably damaging Het
Tep1 A G 14: 50,836,768 F1887L possibly damaging Het
Tet1 A T 10: 62,878,209 C602* probably null Het
Tnfrsf19 A G 14: 60,972,036 S262P possibly damaging Het
Trim5 T C 7: 104,265,684 I393V probably benign Het
Trpm6 A G 19: 18,853,587 E1272G probably benign Het
Ttc21b A T 2: 66,188,326 Y1246N probably damaging Het
Ttll3 T A 6: 113,398,777 L151H probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Ubr1 A T 2: 120,946,657 Y276N probably benign Het
Uggt1 A G 1: 36,179,670 S59P probably benign Het
Unc45a T C 7: 80,326,344 T796A probably damaging Het
Unc5b C A 10: 60,778,940 V193F possibly damaging Het
Upp1 G T 11: 9,129,590 M50I probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp715 T C 7: 43,299,336 Y400C possibly damaging Het
Zfp955b T C 17: 33,302,522 Y322H probably benign Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75725971 missense probably damaging 0.99
IGL00332:Akap13 APN 7 75728919 missense probably damaging 1.00
IGL00481:Akap13 APN 7 75723895 missense probably damaging 1.00
IGL00590:Akap13 APN 7 75610669 missense probably benign 0.01
IGL00655:Akap13 APN 7 75704398 missense probably damaging 0.99
IGL00766:Akap13 APN 7 75704512 missense probably damaging 0.96
IGL00818:Akap13 APN 7 75609727 missense probably benign 0.00
IGL00826:Akap13 APN 7 75677447 missense probably damaging 1.00
IGL01014:Akap13 APN 7 75750633 utr 3 prime probably benign
IGL01090:Akap13 APN 7 75666531 missense probably benign 0.44
IGL01155:Akap13 APN 7 75569936 missense probably damaging 1.00
IGL01326:Akap13 APN 7 75725348 missense probably benign 0.30
IGL01456:Akap13 APN 7 75602847 missense probably damaging 0.98
IGL01460:Akap13 APN 7 75747846 missense probably benign 0.29
IGL01568:Akap13 APN 7 75608522 nonsense probably null 0.00
IGL01610:Akap13 APN 7 75720180 missense possibly damaging 0.71
IGL01610:Akap13 APN 7 75747605 missense probably damaging 1.00
IGL01615:Akap13 APN 7 75697393 missense probably damaging 1.00
IGL01667:Akap13 APN 7 75570019 missense probably damaging 1.00
IGL01705:Akap13 APN 7 75746767 missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75666545 missense probably benign 0.27
IGL02269:Akap13 APN 7 75602911 missense probably benign
IGL02421:Akap13 APN 7 75717806 missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75609188 missense probably damaging 0.96
IGL02944:Akap13 APN 7 75608657 missense probably benign
IGL03051:Akap13 APN 7 75610485 nonsense probably null
IGL03160:Akap13 APN 7 75730417 missense probably damaging 1.00
IGL03245:Akap13 APN 7 75609752 missense probably damaging 0.99
R0254:Akap13 UTSW 7 75736604 splice site probably benign
R0310:Akap13 UTSW 7 75614930 missense probably damaging 0.99
R0373:Akap13 UTSW 7 75730500 missense probably damaging 1.00
R0408:Akap13 UTSW 7 75746796 missense probably damaging 1.00
R0631:Akap13 UTSW 7 75614996 missense probably damaging 0.99
R0646:Akap13 UTSW 7 75747746 missense probably damaging 1.00
R0781:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75725380 missense probably damaging 1.00
R1004:Akap13 UTSW 7 75687286 missense probably damaging 0.99
R1024:Akap13 UTSW 7 75677409 missense probably damaging 1.00
R1110:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75586193 missense probably damaging 0.97
R1442:Akap13 UTSW 7 75735778 missense probably damaging 0.99
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75677194 missense probably damaging 1.00
R1773:Akap13 UTSW 7 75683451 missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1786:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1791:Akap13 UTSW 7 75611035 missense probably benign 0.00
R1819:Akap13 UTSW 7 75608705 missense probably benign 0.04
R1879:Akap13 UTSW 7 75610727 missense probably benign 0.01
R1989:Akap13 UTSW 7 75704516 missense probably benign 0.01
R2016:Akap13 UTSW 7 75704531 missense probably damaging 0.99
R2092:Akap13 UTSW 7 75610570 missense probably benign 0.05
R2126:Akap13 UTSW 7 75725304 missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2132:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2133:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2251:Akap13 UTSW 7 75739477 missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75666550 missense probably damaging 1.00
R3713:Akap13 UTSW 7 75586181 missense probably damaging 0.98
R3731:Akap13 UTSW 7 75611377 missense probably benign 0.39
R3765:Akap13 UTSW 7 75608837 missense probably benign 0.04
R3788:Akap13 UTSW 7 75702153 critical splice donor site probably null
R3793:Akap13 UTSW 7 75610141 missense probably benign 0.00
R3970:Akap13 UTSW 7 75569951 nonsense probably null
R4205:Akap13 UTSW 7 75610919 missense probably benign 0.05
R4257:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R4374:Akap13 UTSW 7 75608984 missense probably damaging 0.96
R4448:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4450:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4457:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4458:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4466:Akap13 UTSW 7 75602773 splice site probably null
R4632:Akap13 UTSW 7 75666553 missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4669:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4671:Akap13 UTSW 7 75579564 nonsense probably null
R4821:Akap13 UTSW 7 75677507 intron probably benign
R4868:Akap13 UTSW 7 75743504 missense probably damaging 1.00
R4894:Akap13 UTSW 7 75725320 missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75749240 missense probably benign 0.22
R4962:Akap13 UTSW 7 75749430 missense probably damaging 0.98
R4988:Akap13 UTSW 7 75730528 missense probably damaging 1.00
R5119:Akap13 UTSW 7 75687252 missense probably damaging 0.98
R5141:Akap13 UTSW 7 75609614 missense probably benign 0.18
R5419:Akap13 UTSW 7 75610243 missense probably benign 0.01
R5427:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75602904 missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75602830 missense probably damaging 1.00
R5458:Akap13 UTSW 7 75586301 missense probably damaging 1.00
R5636:Akap13 UTSW 7 75704372 missense probably damaging 0.96
R5643:Akap13 UTSW 7 75702154 critical splice donor site probably null
R5898:Akap13 UTSW 7 75729146 missense probably damaging 1.00
R5932:Akap13 UTSW 7 75610184 missense probably damaging 1.00
R6135:Akap13 UTSW 7 75609908 missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75677416 missense probably damaging 1.00
R6182:Akap13 UTSW 7 75586280 missense probably benign 0.45
R6310:Akap13 UTSW 7 75749193 missense probably damaging 0.99
R6346:Akap13 UTSW 7 75685254 missense probably damaging 1.00
R6466:Akap13 UTSW 7 75727044 missense probably benign 0.01
R6605:Akap13 UTSW 7 75579768 missense probably damaging 0.98
R6617:Akap13 UTSW 7 75730363 missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75569981 missense probably damaging 1.00
R6703:Akap13 UTSW 7 75602898 missense probably damaging 1.00
R6750:Akap13 UTSW 7 75739458 missense probably benign 0.03
R7069:Akap13 UTSW 7 75610262 missense probably benign 0.29
R7116:Akap13 UTSW 7 75720195 missense probably benign 0.00
R7158:Akap13 UTSW 7 75579594 missense probably damaging 0.97
R7159:Akap13 UTSW 7 75730579 missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7468:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7471:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7472:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7477:Akap13 UTSW 7 75749247 missense probably benign
R7636:Akap13 UTSW 7 75609873 missense probably benign 0.04
R7650:Akap13 UTSW 7 75643454 missense probably benign 0.20
R7671:Akap13 UTSW 7 75569900 missense probably damaging 1.00
R7681:Akap13 UTSW 7 75728796 missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75677258 missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75610328 missense probably benign 0.00
R7816:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7817:Akap13 UTSW 7 75730465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGACACAGTCACTTCTGACAC -3'
(R):5'- TATTTCCCATGCTGGTCCGAAGCTC -3'

Sequencing Primer
(F):5'- TTCTGACACTGTGAAAAATACCCAG -3'
(R):5'- GTCCGAAGCTCTACAGCAG -3'
Posted On2013-04-24