Mutagenetix > Incidental Mutations

Incidental Mutation 'R0373:Akap13'

30610

Institutional Source

Beutler Lab

Gene Symbol

Akap13

Ensembl Gene

ENSMUSG00000066406

Gene Name

A kinase (PRKA) anchor protein 13

Synonyms

AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik

MMRRC Submission

038579-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0373 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75455534-75754609 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75730500 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 2193 (S2193T)

Ref Sequence

ENSEMBL: ENSMUSP00000147237 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207239] [ENSMUST00000207750]

Predicted Effect

probably benign
Transcript: ENSMUST00000147005
AA Change: S2193T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: S2193T

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
internal_repeat_1	485	695	4.85e-5	PROSPERO
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
Pfam:RII_binding_1	1218	1235	4.3e-6	PFAM
low complexity region	1429	1444	N/A	INTRINSIC
low complexity region	1479	1501	N/A	INTRINSIC
low complexity region	1601	1612	N/A	INTRINSIC
low complexity region	1738	1768	N/A	INTRINSIC
C1	1773	1819	1.95e-4	SMART
low complexity region	1876	1887	N/A	INTRINSIC
RhoGEF	1979	2171	1.28e-61	SMART
PH	2213	2316	2.94e-11	SMART
coiled coil region	2326	2363	N/A	INTRINSIC
low complexity region	2411	2430	N/A	INTRINSIC
low complexity region	2462	2472	N/A	INTRINSIC
coiled coil region	2551	2664	N/A	INTRINSIC
low complexity region	2746	2752	N/A	INTRINSIC
low complexity region	2758	2771	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166315
AA Change: S2175T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: S2175T

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
low complexity region	1433	1448	N/A	INTRINSIC
low complexity region	1483	1505	N/A	INTRINSIC
low complexity region	1583	1594	N/A	INTRINSIC
low complexity region	1720	1750	N/A	INTRINSIC
C1	1755	1801	1.95e-4	SMART
low complexity region	1858	1869	N/A	INTRINSIC
RhoGEF	1961	2153	1.28e-61	SMART
PH	2195	2298	2.94e-11	SMART
coiled coil region	2308	2345	N/A	INTRINSIC
low complexity region	2393	2412	N/A	INTRINSIC
low complexity region	2444	2454	N/A	INTRINSIC
coiled coil region	2533	2646	N/A	INTRINSIC
low complexity region	2728	2734	N/A	INTRINSIC
low complexity region	2740	2753	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000207239
AA Change: S474T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000207750
AA Change: S2193T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.8%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	A	T	3: 138,173,582	L235Q	probably damaging	Het
Adam6b	T	A	12: 113,490,655	V364D	probably benign	Het
Anapc11	T	C	11: 120,605,377	V69A	probably benign	Het
Ankmy1	C	T	1: 92,896,190	R118Q	probably damaging	Het
Ankrd27	T	C	7: 35,638,053	S931P	probably benign	Het
Atp6v1c2	G	A	12: 17,288,168	R280C	probably damaging	Het
Bbs10	T	A	10: 111,300,052	I342N	probably damaging	Het
Calhm2	T	C	19: 47,132,950	D260G	possibly damaging	Het
Camk2a	A	G	18: 60,958,238	E264G	probably damaging	Het
Ccdc146	T	A	5: 21,319,545	M270L	probably benign	Het
Cdc16	A	G	8: 13,779,264	T517A	probably benign	Het
Ces1g	T	C	8: 93,331,193	H160R	probably benign	Het
Chst4	T	C	8: 110,030,394	N196S	probably damaging	Het
Ciz1	A	T	2: 32,367,467	N175Y	probably damaging	Het
Cyb5r4	G	A	9: 87,027,040	V57I	probably damaging	Het
Cyth3	A	G	5: 143,684,426		probably benign	Het
Def6	A	G	17: 28,220,180	E255G	probably damaging	Het
Dhtkd1	T	G	2: 5,911,870	Q665P	probably damaging	Het
Dsg3	A	C	18: 20,539,747	D825A	probably damaging	Het
Eif3m	T	C	2: 105,005,000	T242A	probably benign	Het
Emilin3	A	G	2: 160,909,817	F101L	probably benign	Het
Epha7	A	G	4: 28,935,700		probably null	Het
Fam205a1	T	C	4: 42,851,161	I332V	probably benign	Het
Fbxo45	A	T	16: 32,238,405	Y224N	probably damaging	Het
Fhod3	A	T	18: 25,090,104	M836L	possibly damaging	Het
Fut4	C	A	9: 14,751,210	V263F	probably damaging	Het
Ggt1	C	T	10: 75,579,270	T206M	probably benign	Het
Gls	T	C	1: 52,188,699	R79G	probably damaging	Het
Gm436	A	T	4: 144,686,220	M50K	possibly damaging	Het
Grhl1	T	C	12: 24,581,515	S156P	probably benign	Het
Ipo8	C	T	6: 148,775,042	S983N	probably benign	Het
Kcna7	C	T	7: 45,409,444	A385V	probably damaging	Het
Kpnb1	A	T	11: 97,185,090	L40Q	probably damaging	Het
Matn1	A	T	4: 130,950,106	S209C	probably damaging	Het
Mcc	A	G	18: 44,475,222	I501T	probably benign	Het
Mdp1	A	T	14: 55,659,375	F104L	probably damaging	Het
Mib2	A	T	4: 155,656,288	N626K	probably damaging	Het
Mrgprh	T	C	17: 12,876,956	S28P	possibly damaging	Het
Mup-ps23	T	A	4: 61,856,149		noncoding transcript	Het
Myh15	A	G	16: 49,182,959	T1794A	possibly damaging	Het
Myo18a	C	G	11: 77,821,042	P680A	probably benign	Het
Myom2	G	T	8: 15,098,419	D532Y	possibly damaging	Het
Ndufaf5	A	G	2: 140,170,881	N57S	probably benign	Het
Nectin3	C	T	16: 46,458,187	V282M	probably damaging	Het
Nup188	G	T	2: 30,330,988	D997Y	probably damaging	Het
Olfm3	T	C	3: 115,122,805	V462A	probably damaging	Het
Olfr1044	A	C	2: 86,171,706	F37C	probably damaging	Het
Olfr1225	A	T	2: 89,170,413	F266L	probably benign	Het
Olfr305	A	T	7: 86,363,805	C177*	probably null	Het
Opcml	A	G	9: 28,813,398	H164R	possibly damaging	Het
Pacrg	A	G	17: 10,403,418	I209T	probably damaging	Het
Pcf11	T	C	7: 92,661,215	M522V	probably benign	Het
Pck1	T	A	2: 173,153,390	M1K	probably null	Het
Pcm1	G	T	8: 41,276,111	E707*	probably null	Het
Pcsk5	G	A	19: 17,654,849	R318W	probably damaging	Het
Phf11d	A	T	14: 59,353,344	M188K	possibly damaging	Het
Ppip5k2	A	T	1: 97,740,537	C615*	probably null	Het
Prkdc	T	A	16: 15,791,927	S3132T	probably damaging	Het
Prl2c5	A	T	13: 13,183,024		probably benign	Het
Prpsap2	A	G	11: 61,741,000	I177T	possibly damaging	Het
Rad50	A	G	11: 53,650,519	S1297P	probably damaging	Het
Rasip1	T	A	7: 45,635,244	N678K	possibly damaging	Het
Rubcn	A	G	16: 32,835,980	S544P	probably damaging	Het
Rwdd2a	A	T	9: 86,574,400	T210S	possibly damaging	Het
Scd2	A	G	19: 44,303,040	D306G	probably damaging	Het
Sema3b	T	C	9: 107,602,918	N207S	probably benign	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Sipa1l2	C	A	8: 125,464,410	C947F	probably damaging	Het
Slc12a1	A	T	2: 125,226,031	T1013S	probably damaging	Het
Slc18a2	A	T	19: 59,287,367	I461L	probably benign	Het
Slc1a6	C	A	10: 78,801,922	Y427*	probably null	Het
Slc30a4	A	T	2: 122,689,399	I231K	probably damaging	Het
Sos1	G	T	17: 80,453,763	A168D	probably damaging	Het
Sptb	T	C	12: 76,621,371	S651G	probably benign	Het
Stk36	T	C	1: 74,633,620	L1007P	probably damaging	Het
Tek	A	T	4: 94,804,341	N229Y	probably damaging	Het
Tep1	A	G	14: 50,836,768	F1887L	possibly damaging	Het
Tet1	A	T	10: 62,878,209	C602*	probably null	Het
Tnfrsf19	A	G	14: 60,972,036	S262P	possibly damaging	Het
Trim5	T	C	7: 104,265,684	I393V	probably benign	Het
Trpm6	A	G	19: 18,853,587	E1272G	probably benign	Het
Ttc21b	A	T	2: 66,188,326	Y1246N	probably damaging	Het
Ttll3	T	A	6: 113,398,777	L151H	probably damaging	Het
U2surp	C	T	9: 95,484,443	V470I	probably benign	Het
Ubr1	A	T	2: 120,946,657	Y276N	probably benign	Het
Uggt1	A	G	1: 36,179,670	S59P	probably benign	Het
Unc45a	T	C	7: 80,326,344	T796A	probably damaging	Het
Unc5b	C	A	10: 60,778,940	V193F	possibly damaging	Het
Upp1	G	T	11: 9,129,590	M50I	probably benign	Het
Vps18	C	T	2: 119,293,905	R438C	probably damaging	Het
Zfp715	T	C	7: 43,299,336	Y400C	possibly damaging	Het
Zfp955b	T	C	17: 33,302,522	Y322H	probably benign	Het

Other mutations in Akap13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Akap13	APN	7	75725971	missense	probably damaging	0.99
IGL00332:Akap13	APN	7	75728919	missense	probably damaging	1.00
IGL00481:Akap13	APN	7	75723895	missense	probably damaging	1.00
IGL00590:Akap13	APN	7	75610669	missense	probably benign	0.01
IGL00655:Akap13	APN	7	75704398	missense	probably damaging	0.99
IGL00766:Akap13	APN	7	75704512	missense	probably damaging	0.96
IGL00818:Akap13	APN	7	75609727	missense	probably benign	0.00
IGL00826:Akap13	APN	7	75677447	missense	probably damaging	1.00
IGL01014:Akap13	APN	7	75750633	utr 3 prime	probably benign
IGL01090:Akap13	APN	7	75666531	missense	probably benign	0.44
IGL01155:Akap13	APN	7	75569936	missense	probably damaging	1.00
IGL01326:Akap13	APN	7	75725348	missense	probably benign	0.30
IGL01456:Akap13	APN	7	75602847	missense	probably damaging	0.98
IGL01460:Akap13	APN	7	75747846	missense	probably benign	0.29
IGL01568:Akap13	APN	7	75608522	nonsense	probably null	0.00
IGL01610:Akap13	APN	7	75720180	missense	possibly damaging	0.71
IGL01610:Akap13	APN	7	75747605	missense	probably damaging	1.00
IGL01615:Akap13	APN	7	75697393	missense	probably damaging	1.00
IGL01667:Akap13	APN	7	75570019	missense	probably damaging	1.00
IGL01705:Akap13	APN	7	75746767	missense	possibly damaging	0.86
IGL02070:Akap13	APN	7	75666545	missense	probably benign	0.27
IGL02269:Akap13	APN	7	75602911	missense	probably benign
IGL02421:Akap13	APN	7	75717806	missense	possibly damaging	0.66
IGL02870:Akap13	APN	7	75609188	missense	probably damaging	0.96
IGL02944:Akap13	APN	7	75608657	missense	probably benign
IGL03051:Akap13	APN	7	75610485	nonsense	probably null
IGL03160:Akap13	APN	7	75730417	missense	probably damaging	1.00
IGL03245:Akap13	APN	7	75609752	missense	probably damaging	0.99
R0254:Akap13	UTSW	7	75736604	splice site	probably benign
R0310:Akap13	UTSW	7	75614930	missense	probably damaging	0.99
R0373:Akap13	UTSW	7	75609929	missense	probably benign	0.00
R0408:Akap13	UTSW	7	75746796	missense	probably damaging	1.00
R0631:Akap13	UTSW	7	75614996	missense	probably damaging	0.99
R0646:Akap13	UTSW	7	75747746	missense	probably damaging	1.00
R0781:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R0845:Akap13	UTSW	7	75725380	missense	probably damaging	1.00
R1004:Akap13	UTSW	7	75687286	missense	probably damaging	0.99
R1024:Akap13	UTSW	7	75677409	missense	probably damaging	1.00
R1110:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R1346:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1349:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1372:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1387:Akap13	UTSW	7	75586193	missense	probably damaging	0.97
R1442:Akap13	UTSW	7	75735778	missense	probably damaging	0.99
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1584:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1696:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1738:Akap13	UTSW	7	75677194	missense	probably damaging	1.00
R1773:Akap13	UTSW	7	75683451	missense	possibly damaging	0.80
R1785:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1786:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1791:Akap13	UTSW	7	75611035	missense	probably benign	0.00
R1819:Akap13	UTSW	7	75608705	missense	probably benign	0.04
R1879:Akap13	UTSW	7	75610727	missense	probably benign	0.01
R1989:Akap13	UTSW	7	75704516	missense	probably benign	0.01
R2016:Akap13	UTSW	7	75704531	missense	probably damaging	0.99
R2092:Akap13	UTSW	7	75610570	missense	probably benign	0.05
R2126:Akap13	UTSW	7	75725304	missense	possibly damaging	0.95
R2131:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2132:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2133:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2251:Akap13	UTSW	7	75739477	missense	possibly damaging	0.50
R3704:Akap13	UTSW	7	75666550	missense	probably damaging	1.00
R3713:Akap13	UTSW	7	75586181	missense	probably damaging	0.98
R3731:Akap13	UTSW	7	75611377	missense	probably benign	0.39
R3765:Akap13	UTSW	7	75608837	missense	probably benign	0.04
R3788:Akap13	UTSW	7	75702153	critical splice donor site	probably null
R3793:Akap13	UTSW	7	75610141	missense	probably benign	0.00
R3970:Akap13	UTSW	7	75569951	nonsense	probably null
R4205:Akap13	UTSW	7	75610919	missense	probably benign	0.05
R4257:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R4374:Akap13	UTSW	7	75608984	missense	probably damaging	0.96
R4448:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4450:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4457:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4458:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4466:Akap13	UTSW	7	75602773	splice site	probably null
R4632:Akap13	UTSW	7	75666553	missense	possibly damaging	0.91
R4667:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4669:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4671:Akap13	UTSW	7	75579564	nonsense	probably null
R4821:Akap13	UTSW	7	75677507	intron	probably benign
R4868:Akap13	UTSW	7	75743504	missense	probably damaging	1.00
R4894:Akap13	UTSW	7	75725320	missense	possibly damaging	0.76
R4943:Akap13	UTSW	7	75749240	missense	probably benign	0.22
R4962:Akap13	UTSW	7	75749430	missense	probably damaging	0.98
R4988:Akap13	UTSW	7	75730528	missense	probably damaging	1.00
R5119:Akap13	UTSW	7	75687252	missense	probably damaging	0.98
R5141:Akap13	UTSW	7	75609614	missense	probably benign	0.18
R5419:Akap13	UTSW	7	75610243	missense	probably benign	0.01
R5427:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R5429:Akap13	UTSW	7	75602904	missense	possibly damaging	0.70
R5432:Akap13	UTSW	7	75602830	missense	probably damaging	1.00
R5458:Akap13	UTSW	7	75586301	missense	probably damaging	1.00
R5636:Akap13	UTSW	7	75704372	missense	probably damaging	0.96
R5643:Akap13	UTSW	7	75702154	critical splice donor site	probably null
R5898:Akap13	UTSW	7	75729146	missense	probably damaging	1.00
R5932:Akap13	UTSW	7	75610184	missense	probably damaging	1.00
R6135:Akap13	UTSW	7	75609908	missense	possibly damaging	0.94
R6137:Akap13	UTSW	7	75677416	missense	probably damaging	1.00
R6182:Akap13	UTSW	7	75586280	missense	probably benign	0.45
R6310:Akap13	UTSW	7	75749193	missense	probably damaging	0.99
R6346:Akap13	UTSW	7	75685254	missense	probably damaging	1.00
R6466:Akap13	UTSW	7	75727044	missense	probably benign	0.01
R6605:Akap13	UTSW	7	75579768	missense	probably damaging	0.98
R6617:Akap13	UTSW	7	75730363	missense	possibly damaging	0.95
R6621:Akap13	UTSW	7	75569981	missense	probably damaging	1.00
R6703:Akap13	UTSW	7	75602898	missense	probably damaging	1.00
R6750:Akap13	UTSW	7	75739458	missense	probably benign	0.03
R7069:Akap13	UTSW	7	75610262	missense	probably benign	0.29
R7116:Akap13	UTSW	7	75720195	missense	probably benign	0.00
R7158:Akap13	UTSW	7	75579594	missense	probably damaging	0.97
R7159:Akap13	UTSW	7	75730579	missense	possibly damaging	0.72
R7467:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7468:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7471:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7472:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7477:Akap13	UTSW	7	75749247	missense	probably benign
R7636:Akap13	UTSW	7	75609873	missense	probably benign	0.04
R7650:Akap13	UTSW	7	75643454	missense	probably benign	0.20
R7671:Akap13	UTSW	7	75569900	missense	probably damaging	1.00
R7681:Akap13	UTSW	7	75728796	missense	possibly damaging	0.91
R7752:Akap13	UTSW	7	75677258	missense	possibly damaging	0.74
R7784:Akap13	UTSW	7	75610328	missense	probably benign	0.00
R7816:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7817:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7834:Akap13	UTSW	7	75742642	missense	possibly damaging	0.85
R7880:Akap13	UTSW	7	75586216	missense	probably damaging	0.97
R7942:Akap13	UTSW	7	75611470	missense	possibly damaging	0.50
R8006:Akap13	UTSW	7	75579696	missense	probably damaging	1.00
R8009:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8011:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8012:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8013:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8016:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8089:Akap13	UTSW	7	75610592	missense	possibly damaging	0.94
R8138:Akap13	UTSW	7	75702231	splice site	probably null
R8174:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R8298:Akap13	UTSW	7	75747804	missense	probably damaging	1.00
R8444:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8445:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8512:Akap13	UTSW	7	75611086	missense	probably damaging	0.99
Z1176:Akap13	UTSW	7	75730552	missense	probably damaging	0.99
Z1177:Akap13	UTSW	7	75615005	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- CTCTCCCAAGACAATGAAGTGGAGC -3'
(R):5'- TGCCACTGACCTGATCCCACAATG -3'

Sequencing Primer
(F):5'- GGAGCAGGAAGACCTCACTC -3'
(R):5'- GGAGTATGTCTTCCCCAACAG -3'

Posted On

2013-04-24