Incidental Mutation 'R0373:Myom2'
ID 30616
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Name myomesin 2
Synonyms
MMRRC Submission 038579-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.149) question?
Stock # R0373 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 15107653-15183410 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 15148419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 532 (D532Y)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
AlphaFold Q14BI5
Predicted Effect possibly damaging
Transcript: ENSMUST00000033842
AA Change: D532Y

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: D532Y

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117573
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A T 3: 137,879,343 (GRCm39) L235Q probably damaging Het
Aadacl4fm4 A T 4: 144,412,790 (GRCm39) M50K possibly damaging Het
Adam6b T A 12: 113,454,275 (GRCm39) V364D probably benign Het
Akap13 T C 7: 75,259,677 (GRCm39) L767P probably benign Het
Akap13 T A 7: 75,380,248 (GRCm39) S2193T probably damaging Het
Anapc11 T C 11: 120,496,203 (GRCm39) V69A probably benign Het
Ankmy1 C T 1: 92,823,912 (GRCm39) R118Q probably damaging Het
Ankrd27 T C 7: 35,337,478 (GRCm39) S931P probably benign Het
Atp6v1c2 G A 12: 17,338,169 (GRCm39) R280C probably damaging Het
Bbs10 T A 10: 111,135,913 (GRCm39) I342N probably damaging Het
Calhm2 T C 19: 47,121,389 (GRCm39) D260G possibly damaging Het
Camk2a A G 18: 61,091,310 (GRCm39) E264G probably damaging Het
Ccdc146 T A 5: 21,524,543 (GRCm39) M270L probably benign Het
Cdc16 A G 8: 13,829,264 (GRCm39) T517A probably benign Het
Ces1g T C 8: 94,057,821 (GRCm39) H160R probably benign Het
Chst4 T C 8: 110,757,026 (GRCm39) N196S probably damaging Het
Ciz1 A T 2: 32,257,479 (GRCm39) N175Y probably damaging Het
Cyb5r4 G A 9: 86,909,093 (GRCm39) V57I probably damaging Het
Cyth3 A G 5: 143,670,181 (GRCm39) probably benign Het
Def6 A G 17: 28,439,154 (GRCm39) E255G probably damaging Het
Dhtkd1 T G 2: 5,916,681 (GRCm39) Q665P probably damaging Het
Dsg3 A C 18: 20,672,804 (GRCm39) D825A probably damaging Het
Eif3m T C 2: 104,835,345 (GRCm39) T242A probably benign Het
Emilin3 A G 2: 160,751,737 (GRCm39) F101L probably benign Het
Epha7 A G 4: 28,935,700 (GRCm39) probably null Het
Fbxo45 A T 16: 32,057,223 (GRCm39) Y224N probably damaging Het
Fhod3 A T 18: 25,223,161 (GRCm39) M836L possibly damaging Het
Fut4 C A 9: 14,662,506 (GRCm39) V263F probably damaging Het
Ggt1 C T 10: 75,415,104 (GRCm39) T206M probably benign Het
Gls T C 1: 52,227,858 (GRCm39) R79G probably damaging Het
Grhl1 T C 12: 24,631,514 (GRCm39) S156P probably benign Het
Ipo8 C T 6: 148,676,540 (GRCm39) S983N probably benign Het
Kcna7 C T 7: 45,058,868 (GRCm39) A385V probably damaging Het
Kpnb1 A T 11: 97,075,916 (GRCm39) L40Q probably damaging Het
Matn1 A T 4: 130,677,417 (GRCm39) S209C probably damaging Het
Mcc A G 18: 44,608,289 (GRCm39) I501T probably benign Het
Mdp1 A T 14: 55,896,832 (GRCm39) F104L probably damaging Het
Mib2 A T 4: 155,740,745 (GRCm39) N626K probably damaging Het
Mrgprh T C 17: 13,095,843 (GRCm39) S28P possibly damaging Het
Mup-ps23 T A 4: 61,774,386 (GRCm39) noncoding transcript Het
Myh15 A G 16: 49,003,322 (GRCm39) T1794A possibly damaging Het
Myo18a C G 11: 77,711,868 (GRCm39) P680A probably benign Het
Ndufaf5 A G 2: 140,012,801 (GRCm39) N57S probably benign Het
Nectin3 C T 16: 46,278,550 (GRCm39) V282M probably damaging Het
Nup188 G T 2: 30,221,000 (GRCm39) D997Y probably damaging Het
Olfm3 T C 3: 114,916,454 (GRCm39) V462A probably damaging Het
Opcml A G 9: 28,724,694 (GRCm39) H164R possibly damaging Het
Or14a259 A T 7: 86,013,013 (GRCm39) C177* probably null Het
Or4c120 A T 2: 89,000,757 (GRCm39) F266L probably benign Het
Or8u9 A C 2: 86,002,050 (GRCm39) F37C probably damaging Het
Pacrg A G 17: 10,622,347 (GRCm39) I209T probably damaging Het
Pcf11 T C 7: 92,310,423 (GRCm39) M522V probably benign Het
Pck1 T A 2: 172,995,183 (GRCm39) M1K probably null Het
Pcm1 G T 8: 41,729,148 (GRCm39) E707* probably null Het
Pcsk5 G A 19: 17,632,213 (GRCm39) R318W probably damaging Het
Phf11d A T 14: 59,590,793 (GRCm39) M188K possibly damaging Het
Ppip5k2 A T 1: 97,668,262 (GRCm39) C615* probably null Het
Prkdc T A 16: 15,609,791 (GRCm39) S3132T probably damaging Het
Prl2c5 A T 13: 13,357,609 (GRCm39) probably benign Het
Prpsap2 A G 11: 61,631,826 (GRCm39) I177T possibly damaging Het
Rad50 A G 11: 53,541,346 (GRCm39) S1297P probably damaging Het
Rasip1 T A 7: 45,284,668 (GRCm39) N678K possibly damaging Het
Rubcn A G 16: 32,656,350 (GRCm39) S544P probably damaging Het
Rwdd2a A T 9: 86,456,453 (GRCm39) T210S possibly damaging Het
Scd2 A G 19: 44,291,479 (GRCm39) D306G probably damaging Het
Sema3b T C 9: 107,480,117 (GRCm39) N207S probably benign Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Sipa1l2 C A 8: 126,191,149 (GRCm39) C947F probably damaging Het
Slc12a1 A T 2: 125,067,951 (GRCm39) T1013S probably damaging Het
Slc18a2 A T 19: 59,275,799 (GRCm39) I461L probably benign Het
Slc1a6 C A 10: 78,637,756 (GRCm39) Y427* probably null Het
Slc30a4 A T 2: 122,531,319 (GRCm39) I231K probably damaging Het
Sos1 G T 17: 80,761,192 (GRCm39) A168D probably damaging Het
Spata31f1a T C 4: 42,851,161 (GRCm39) I332V probably benign Het
Sptb T C 12: 76,668,145 (GRCm39) S651G probably benign Het
Stk36 T C 1: 74,672,779 (GRCm39) L1007P probably damaging Het
Tek A T 4: 94,692,578 (GRCm39) N229Y probably damaging Het
Tep1 A G 14: 51,074,225 (GRCm39) F1887L possibly damaging Het
Tet1 A T 10: 62,713,988 (GRCm39) C602* probably null Het
Tnfrsf19 A G 14: 61,209,485 (GRCm39) S262P possibly damaging Het
Trim5 T C 7: 103,914,891 (GRCm39) I393V probably benign Het
Trpm6 A G 19: 18,830,951 (GRCm39) E1272G probably benign Het
Ttc21b A T 2: 66,018,670 (GRCm39) Y1246N probably damaging Het
Ttll3 T A 6: 113,375,738 (GRCm39) L151H probably damaging Het
U2surp C T 9: 95,366,496 (GRCm39) V470I probably benign Het
Ubr1 A T 2: 120,777,138 (GRCm39) Y276N probably benign Het
Uggt1 A G 1: 36,218,751 (GRCm39) S59P probably benign Het
Unc45a T C 7: 79,976,092 (GRCm39) T796A probably damaging Het
Unc5b C A 10: 60,614,719 (GRCm39) V193F possibly damaging Het
Upp1 G T 11: 9,079,590 (GRCm39) M50I probably benign Het
Vps18 C T 2: 119,124,386 (GRCm39) R438C probably damaging Het
Zfp715 T C 7: 42,948,760 (GRCm39) Y400C possibly damaging Het
Zfp955b T C 17: 33,521,496 (GRCm39) Y322H probably benign Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15,119,490 (GRCm39) missense probably damaging 1.00
IGL00426:Myom2 APN 8 15,119,502 (GRCm39) missense probably benign 0.00
IGL00503:Myom2 APN 8 15,164,289 (GRCm39) splice site probably null
IGL01515:Myom2 APN 8 15,172,655 (GRCm39) missense probably benign 0.15
IGL01649:Myom2 APN 8 15,163,755 (GRCm39) missense probably benign 0.24
IGL01658:Myom2 APN 8 15,127,880 (GRCm39) missense probably damaging 1.00
IGL01786:Myom2 APN 8 15,156,330 (GRCm39) missense probably damaging 0.99
IGL01924:Myom2 APN 8 15,119,685 (GRCm39) missense probably benign 0.37
IGL01929:Myom2 APN 8 15,167,698 (GRCm39) missense probably damaging 0.96
IGL02016:Myom2 APN 8 15,175,195 (GRCm39) missense probably benign 0.01
IGL02511:Myom2 APN 8 15,115,743 (GRCm39) missense probably benign
IGL02558:Myom2 APN 8 15,164,237 (GRCm39) missense probably benign 0.31
IGL02944:Myom2 APN 8 15,154,065 (GRCm39) critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15,173,442 (GRCm39) splice site probably benign
IGL03195:Myom2 APN 8 15,161,844 (GRCm39) nonsense probably null
IGL03288:Myom2 APN 8 15,172,679 (GRCm39) missense probably damaging 0.99
IGL03402:Myom2 APN 8 15,115,731 (GRCm39) missense probably benign
yomama UTSW 8 15,182,895 (GRCm39) missense probably benign 0.10
yoyoma UTSW 8 15,182,667 (GRCm39) missense probably damaging 0.99
R0069:Myom2 UTSW 8 15,167,624 (GRCm39) missense probably benign
R0116:Myom2 UTSW 8 15,167,633 (GRCm39) missense probably damaging 1.00
R0131:Myom2 UTSW 8 15,133,329 (GRCm39) missense probably damaging 0.98
R0463:Myom2 UTSW 8 15,154,123 (GRCm39) missense probably benign 0.09
R0544:Myom2 UTSW 8 15,119,796 (GRCm39) missense probably damaging 1.00
R0629:Myom2 UTSW 8 15,119,783 (GRCm39) missense probably damaging 0.98
R0634:Myom2 UTSW 8 15,169,216 (GRCm39) splice site probably benign
R0645:Myom2 UTSW 8 15,167,698 (GRCm39) missense probably damaging 0.96
R0730:Myom2 UTSW 8 15,149,326 (GRCm39) missense probably benign 0.00
R0744:Myom2 UTSW 8 15,182,924 (GRCm39) nonsense probably null
R0836:Myom2 UTSW 8 15,182,924 (GRCm39) nonsense probably null
R1033:Myom2 UTSW 8 15,158,934 (GRCm39) missense probably benign 0.04
R1103:Myom2 UTSW 8 15,160,827 (GRCm39) missense probably benign 0.22
R1110:Myom2 UTSW 8 15,172,413 (GRCm39) missense probably benign 0.44
R1208:Myom2 UTSW 8 15,134,631 (GRCm39) missense probably damaging 1.00
R1208:Myom2 UTSW 8 15,134,631 (GRCm39) missense probably damaging 1.00
R1353:Myom2 UTSW 8 15,156,424 (GRCm39) missense probably damaging 1.00
R1530:Myom2 UTSW 8 15,172,384 (GRCm39) missense probably damaging 1.00
R1544:Myom2 UTSW 8 15,154,059 (GRCm39) splice site probably benign
R1576:Myom2 UTSW 8 15,134,556 (GRCm39) missense probably damaging 1.00
R1758:Myom2 UTSW 8 15,115,795 (GRCm39) missense probably benign 0.00
R1884:Myom2 UTSW 8 15,164,278 (GRCm39) missense probably benign 0.01
R1908:Myom2 UTSW 8 15,131,023 (GRCm39) missense probably damaging 1.00
R1962:Myom2 UTSW 8 15,182,599 (GRCm39) splice site probably null
R1977:Myom2 UTSW 8 15,135,263 (GRCm39) missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15,181,151 (GRCm39) missense probably damaging 1.00
R2049:Myom2 UTSW 8 15,156,379 (GRCm39) missense probably damaging 0.97
R2155:Myom2 UTSW 8 15,134,555 (GRCm39) missense probably damaging 0.98
R2314:Myom2 UTSW 8 15,113,927 (GRCm39) missense probably damaging 0.99
R2350:Myom2 UTSW 8 15,158,835 (GRCm39) missense probably benign 0.09
R2358:Myom2 UTSW 8 15,162,018 (GRCm39) missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15,148,348 (GRCm39) missense probably benign 0.00
R3418:Myom2 UTSW 8 15,135,294 (GRCm39) missense probably benign 0.01
R3606:Myom2 UTSW 8 15,119,775 (GRCm39) missense probably damaging 1.00
R3607:Myom2 UTSW 8 15,119,775 (GRCm39) missense probably damaging 1.00
R3735:Myom2 UTSW 8 15,119,676 (GRCm39) missense probably benign 0.01
R3756:Myom2 UTSW 8 15,152,650 (GRCm39) missense probably benign 0.11
R3902:Myom2 UTSW 8 15,154,165 (GRCm39) missense probably benign
R3951:Myom2 UTSW 8 15,134,556 (GRCm39) missense probably benign 0.35
R4240:Myom2 UTSW 8 15,182,895 (GRCm39) missense probably benign 0.10
R4361:Myom2 UTSW 8 15,162,018 (GRCm39) missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15,156,459 (GRCm39) missense probably benign 0.02
R4736:Myom2 UTSW 8 15,131,271 (GRCm39) missense probably damaging 0.99
R5010:Myom2 UTSW 8 15,133,310 (GRCm39) missense probably damaging 0.98
R5108:Myom2 UTSW 8 15,182,667 (GRCm39) missense probably damaging 0.99
R5370:Myom2 UTSW 8 15,149,343 (GRCm39) missense probably benign 0.10
R5427:Myom2 UTSW 8 15,163,764 (GRCm39) missense probably benign 0.03
R5498:Myom2 UTSW 8 15,179,142 (GRCm39) missense probably benign 0.01
R5504:Myom2 UTSW 8 15,178,879 (GRCm39) missense probably damaging 1.00
R5567:Myom2 UTSW 8 15,152,546 (GRCm39) missense probably benign 0.01
R5743:Myom2 UTSW 8 15,130,914 (GRCm39) missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15,172,705 (GRCm39) missense probably benign 0.01
R5844:Myom2 UTSW 8 15,181,182 (GRCm39) critical splice donor site probably null
R5854:Myom2 UTSW 8 15,158,478 (GRCm39) missense probably benign
R6141:Myom2 UTSW 8 15,113,903 (GRCm39) missense probably damaging 1.00
R6209:Myom2 UTSW 8 15,154,173 (GRCm39) missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15,148,472 (GRCm39) splice site probably null
R6378:Myom2 UTSW 8 15,149,356 (GRCm39) missense probably benign 0.11
R6829:Myom2 UTSW 8 15,172,643 (GRCm39) nonsense probably null
R6913:Myom2 UTSW 8 15,115,710 (GRCm39) missense probably benign
R6957:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6958:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6960:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6961:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6962:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6999:Myom2 UTSW 8 15,134,531 (GRCm39) missense probably benign 0.22
R7148:Myom2 UTSW 8 15,134,577 (GRCm39) missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15,154,114 (GRCm39) missense probably damaging 1.00
R7298:Myom2 UTSW 8 15,148,411 (GRCm39) missense probably damaging 1.00
R7463:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably null 0.94
R7535:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably damaging 1.00
R7573:Myom2 UTSW 8 15,172,450 (GRCm39) missense probably damaging 1.00
R7590:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably damaging 1.00
R7690:Myom2 UTSW 8 15,161,717 (GRCm39) critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15,133,259 (GRCm39) missense probably damaging 1.00
R7822:Myom2 UTSW 8 15,158,454 (GRCm39) missense probably benign
R7948:Myom2 UTSW 8 15,135,306 (GRCm39) missense probably benign 0.00
R8094:Myom2 UTSW 8 15,119,418 (GRCm39) missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15,179,157 (GRCm39) missense probably damaging 1.00
R8292:Myom2 UTSW 8 15,182,888 (GRCm39) missense probably benign 0.01
R8514:Myom2 UTSW 8 15,175,153 (GRCm39) missense possibly damaging 0.65
R8539:Myom2 UTSW 8 15,164,254 (GRCm39) missense probably benign 0.01
R8790:Myom2 UTSW 8 15,169,242 (GRCm39) missense probably damaging 1.00
R8824:Myom2 UTSW 8 15,164,169 (GRCm39) missense possibly damaging 0.82
R8895:Myom2 UTSW 8 15,152,589 (GRCm39) nonsense probably null
R9024:Myom2 UTSW 8 15,113,936 (GRCm39) missense probably damaging 1.00
R9129:Myom2 UTSW 8 15,154,068 (GRCm39) missense probably damaging 1.00
R9224:Myom2 UTSW 8 15,178,804 (GRCm39) missense possibly damaging 0.89
R9237:Myom2 UTSW 8 15,152,591 (GRCm39) missense possibly damaging 0.85
R9321:Myom2 UTSW 8 15,172,464 (GRCm39) missense possibly damaging 0.91
R9341:Myom2 UTSW 8 15,134,633 (GRCm39) missense probably damaging 0.97
R9343:Myom2 UTSW 8 15,134,633 (GRCm39) missense probably damaging 0.97
R9375:Myom2 UTSW 8 15,149,210 (GRCm39) missense probably damaging 1.00
R9455:Myom2 UTSW 8 15,156,293 (GRCm39) missense probably benign 0.31
R9563:Myom2 UTSW 8 15,158,399 (GRCm39) nonsense probably null
R9565:Myom2 UTSW 8 15,158,399 (GRCm39) nonsense probably null
RF001:Myom2 UTSW 8 15,131,418 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCAGAACAGACCTGGACTCCGC -3'
(R):5'- GGTTCCCTCTACAAGATAGCCACCC -3'

Sequencing Primer
(F):5'- CGCTGGGGAGTGCTAAG -3'
(R):5'- ACTGACAGGACCTGCATTTC -3'
Posted On 2013-04-24