Mutagenetix > Incidental Mutations

Incidental Mutation 'R0373:Tep1'

30644

Institutional Source

Beutler Lab

Gene Symbol

Tep1

Ensembl Gene

ENSMUSG00000006281

Gene Name

telomerase associated protein 1

Synonyms

Tp1

MMRRC Submission

038579-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0373 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

50824059-50870560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50836768 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1887 (F1887L)

Ref Sequence

ENSEMBL: ENSMUSP00000006444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006444] [ENSMUST00000227526]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006444
AA Change: F1887L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: F1887L

Domain	Start	End	E-Value	Type
Pfam:TEP1_N	1	29	2.8e-20	PFAM
Pfam:TEP1_N	31	59	1.4e-20	PFAM
Pfam:TEP1_N	61	89	3.1e-20	PFAM
Pfam:TEP1_N	91	119	3e-20	PFAM
low complexity region	195	207	N/A	INTRINSIC
low complexity region	211	229	N/A	INTRINSIC
Pfam:TROVE	230	685	3.2e-136	PFAM
Pfam:DUF4062	909	1020	2.4e-22	PFAM
Pfam:NACHT	1171	1346	9.2e-38	PFAM
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1622	1641	N/A	INTRINSIC
WD40	1673	1711	2.98e-1	SMART
WD40	1714	1752	5.33e0	SMART
WD40	1755	1794	1.52e-4	SMART
WD40	1797	1835	3.27e-4	SMART
WD40	1838	1877	3.09e-1	SMART
WD40	1880	1919	2.24e-2	SMART
WD40	1925	1962	4.95e0	SMART
WD40	1968	2003	2.29e1	SMART
WD40	2008	2045	1.72e0	SMART
WD40	2058	2097	3.89e-11	SMART
WD40	2103	2142	3.93e-7	SMART
WD40	2145	2182	4.38e-5	SMART
WD40	2184	2232	1.24e0	SMART
WD40	2235	2273	1.14e-3	SMART
WD40	2275	2315	4.46e-1	SMART
Blast:WD40	2316	2353	4e-12	BLAST
WD40	2546	2583	6.79e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226430

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227193

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227228

Predicted Effect

probably benign
Transcript: ENSMUST00000227526

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.8%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	A	T	3: 138,173,582	L235Q	probably damaging	Het
Adam6b	T	A	12: 113,490,655	V364D	probably benign	Het
Akap13	T	C	7: 75,609,929	L767P	probably benign	Het
Akap13	T	A	7: 75,730,500	S2193T	probably damaging	Het
Anapc11	T	C	11: 120,605,377	V69A	probably benign	Het
Ankmy1	C	T	1: 92,896,190	R118Q	probably damaging	Het
Ankrd27	T	C	7: 35,638,053	S931P	probably benign	Het
Atp6v1c2	G	A	12: 17,288,168	R280C	probably damaging	Het
Bbs10	T	A	10: 111,300,052	I342N	probably damaging	Het
Calhm2	T	C	19: 47,132,950	D260G	possibly damaging	Het
Camk2a	A	G	18: 60,958,238	E264G	probably damaging	Het
Ccdc146	T	A	5: 21,319,545	M270L	probably benign	Het
Cdc16	A	G	8: 13,779,264	T517A	probably benign	Het
Ces1g	T	C	8: 93,331,193	H160R	probably benign	Het
Chst4	T	C	8: 110,030,394	N196S	probably damaging	Het
Ciz1	A	T	2: 32,367,467	N175Y	probably damaging	Het
Cyb5r4	G	A	9: 87,027,040	V57I	probably damaging	Het
Cyth3	A	G	5: 143,684,426		probably benign	Het
Def6	A	G	17: 28,220,180	E255G	probably damaging	Het
Dhtkd1	T	G	2: 5,911,870	Q665P	probably damaging	Het
Dsg3	A	C	18: 20,539,747	D825A	probably damaging	Het
Eif3m	T	C	2: 105,005,000	T242A	probably benign	Het
Emilin3	A	G	2: 160,909,817	F101L	probably benign	Het
Epha7	A	G	4: 28,935,700		probably null	Het
Fam205a1	T	C	4: 42,851,161	I332V	probably benign	Het
Fbxo45	A	T	16: 32,238,405	Y224N	probably damaging	Het
Fhod3	A	T	18: 25,090,104	M836L	possibly damaging	Het
Fut4	C	A	9: 14,751,210	V263F	probably damaging	Het
Ggt1	C	T	10: 75,579,270	T206M	probably benign	Het
Gls	T	C	1: 52,188,699	R79G	probably damaging	Het
Gm436	A	T	4: 144,686,220	M50K	possibly damaging	Het
Grhl1	T	C	12: 24,581,515	S156P	probably benign	Het
Ipo8	C	T	6: 148,775,042	S983N	probably benign	Het
Kcna7	C	T	7: 45,409,444	A385V	probably damaging	Het
Kpnb1	A	T	11: 97,185,090	L40Q	probably damaging	Het
Matn1	A	T	4: 130,950,106	S209C	probably damaging	Het
Mcc	A	G	18: 44,475,222	I501T	probably benign	Het
Mdp1	A	T	14: 55,659,375	F104L	probably damaging	Het
Mib2	A	T	4: 155,656,288	N626K	probably damaging	Het
Mrgprh	T	C	17: 12,876,956	S28P	possibly damaging	Het
Mup-ps23	T	A	4: 61,856,149		noncoding transcript	Het
Myh15	A	G	16: 49,182,959	T1794A	possibly damaging	Het
Myo18a	C	G	11: 77,821,042	P680A	probably benign	Het
Myom2	G	T	8: 15,098,419	D532Y	possibly damaging	Het
Ndufaf5	A	G	2: 140,170,881	N57S	probably benign	Het
Nectin3	C	T	16: 46,458,187	V282M	probably damaging	Het
Nup188	G	T	2: 30,330,988	D997Y	probably damaging	Het
Olfm3	T	C	3: 115,122,805	V462A	probably damaging	Het
Olfr1044	A	C	2: 86,171,706	F37C	probably damaging	Het
Olfr1225	A	T	2: 89,170,413	F266L	probably benign	Het
Olfr305	A	T	7: 86,363,805	C177*	probably null	Het
Opcml	A	G	9: 28,813,398	H164R	possibly damaging	Het
Pacrg	A	G	17: 10,403,418	I209T	probably damaging	Het
Pcf11	T	C	7: 92,661,215	M522V	probably benign	Het
Pck1	T	A	2: 173,153,390	M1K	probably null	Het
Pcm1	G	T	8: 41,276,111	E707*	probably null	Het
Pcsk5	G	A	19: 17,654,849	R318W	probably damaging	Het
Phf11d	A	T	14: 59,353,344	M188K	possibly damaging	Het
Ppip5k2	A	T	1: 97,740,537	C615*	probably null	Het
Prkdc	T	A	16: 15,791,927	S3132T	probably damaging	Het
Prl2c5	A	T	13: 13,183,024		probably benign	Het
Prpsap2	A	G	11: 61,741,000	I177T	possibly damaging	Het
Rad50	A	G	11: 53,650,519	S1297P	probably damaging	Het
Rasip1	T	A	7: 45,635,244	N678K	possibly damaging	Het
Rubcn	A	G	16: 32,835,980	S544P	probably damaging	Het
Rwdd2a	A	T	9: 86,574,400	T210S	possibly damaging	Het
Scd2	A	G	19: 44,303,040	D306G	probably damaging	Het
Sema3b	T	C	9: 107,602,918	N207S	probably benign	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Sipa1l2	C	A	8: 125,464,410	C947F	probably damaging	Het
Slc12a1	A	T	2: 125,226,031	T1013S	probably damaging	Het
Slc18a2	A	T	19: 59,287,367	I461L	probably benign	Het
Slc1a6	C	A	10: 78,801,922	Y427*	probably null	Het
Slc30a4	A	T	2: 122,689,399	I231K	probably damaging	Het
Sos1	G	T	17: 80,453,763	A168D	probably damaging	Het
Sptb	T	C	12: 76,621,371	S651G	probably benign	Het
Stk36	T	C	1: 74,633,620	L1007P	probably damaging	Het
Tek	A	T	4: 94,804,341	N229Y	probably damaging	Het
Tet1	A	T	10: 62,878,209	C602*	probably null	Het
Tnfrsf19	A	G	14: 60,972,036	S262P	possibly damaging	Het
Trim5	T	C	7: 104,265,684	I393V	probably benign	Het
Trpm6	A	G	19: 18,853,587	E1272G	probably benign	Het
Ttc21b	A	T	2: 66,188,326	Y1246N	probably damaging	Het
Ttll3	T	A	6: 113,398,777	L151H	probably damaging	Het
U2surp	C	T	9: 95,484,443	V470I	probably benign	Het
Ubr1	A	T	2: 120,946,657	Y276N	probably benign	Het
Uggt1	A	G	1: 36,179,670	S59P	probably benign	Het
Unc45a	T	C	7: 80,326,344	T796A	probably damaging	Het
Unc5b	C	A	10: 60,778,940	V193F	possibly damaging	Het
Upp1	G	T	11: 9,129,590	M50I	probably benign	Het
Vps18	C	T	2: 119,293,905	R438C	probably damaging	Het
Zfp715	T	C	7: 43,299,336	Y400C	possibly damaging	Het
Zfp955b	T	C	17: 33,302,522	Y322H	probably benign	Het

Other mutations in Tep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Tep1	APN	14	50843184	missense	probably damaging	1.00
IGL00490:Tep1	APN	14	50833473	missense	probably damaging	0.97
IGL01114:Tep1	APN	14	50850639	missense	probably damaging	0.98
IGL01294:Tep1	APN	14	50829657	splice site	probably benign
IGL01902:Tep1	APN	14	50866091	splice site	probably benign
IGL01910:Tep1	APN	14	50844112	missense	probably benign	0.06
IGL01925:Tep1	APN	14	50824498	unclassified	probably benign
IGL01965:Tep1	APN	14	50863495	splice site	probably benign
IGL02071:Tep1	APN	14	50834049	missense	possibly damaging	0.93
IGL02124:Tep1	APN	14	50854124	unclassified	probably benign
IGL02189:Tep1	APN	14	50826826	missense	probably benign
IGL02252:Tep1	APN	14	50830255	missense	possibly damaging	0.93
IGL02299:Tep1	APN	14	50840671	missense	probably damaging	0.99
IGL02343:Tep1	APN	14	50829247	missense	probably damaging	0.99
IGL02423:Tep1	APN	14	50844620	missense	possibly damaging	0.53
IGL02537:Tep1	APN	14	50836113	missense	probably damaging	0.96
IGL02601:Tep1	APN	14	50833478	nonsense	probably null
IGL02941:Tep1	APN	14	50866037	missense	probably damaging	0.98
IGL02990:Tep1	APN	14	50868246	missense	possibly damaging	0.86
IGL03144:Tep1	APN	14	50844017	splice site	probably benign
IGL03209:Tep1	APN	14	50840703	splice site	probably benign
PIT4305001:Tep1	UTSW	14	50829227	missense	possibly damaging	0.90
PIT4362001:Tep1	UTSW	14	50866053	missense	probably benign	0.23
R0058:Tep1	UTSW	14	50834065	missense	possibly damaging	0.85
R0060:Tep1	UTSW	14	50866029	missense	probably damaging	1.00
R0109:Tep1	UTSW	14	50851916	splice site	probably null
R0123:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0134:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0148:Tep1	UTSW	14	50824789	missense	possibly damaging	0.70
R0240:Tep1	UTSW	14	50863029	splice site	probably benign
R0243:Tep1	UTSW	14	50846987	missense	probably damaging	1.00
R0432:Tep1	UTSW	14	50866823	small deletion	probably benign
R0464:Tep1	UTSW	14	50847684	missense	probably benign	0.00
R0566:Tep1	UTSW	14	50845414	critical splice donor site	probably null
R0691:Tep1	UTSW	14	50866844	nonsense	probably null
R0787:Tep1	UTSW	14	50829230	missense	possibly damaging	0.85
R0972:Tep1	UTSW	14	50824296	unclassified	probably benign
R1263:Tep1	UTSW	14	50845513	missense	possibly damaging	0.84
R1300:Tep1	UTSW	14	50827055	critical splice donor site	probably null
R1327:Tep1	UTSW	14	50853099	missense	probably benign	0.18
R1556:Tep1	UTSW	14	50853042	missense	probably benign	0.06
R1584:Tep1	UTSW	14	50866037	missense	probably damaging	0.98
R1607:Tep1	UTSW	14	50824563	missense	probably null	0.99
R1686:Tep1	UTSW	14	50836788	missense	probably benign	0.12
R1715:Tep1	UTSW	14	50854567	missense	possibly damaging	0.92
R1778:Tep1	UTSW	14	50829622	intron	probably benign
R1993:Tep1	UTSW	14	50824184	missense	possibly damaging	0.93
R2071:Tep1	UTSW	14	50854282	missense	probably benign	0.23
R2104:Tep1	UTSW	14	50850580	splice site	probably benign
R2118:Tep1	UTSW	14	50855572	intron	probably null
R2119:Tep1	UTSW	14	50838986	missense	probably benign	0.13
R2208:Tep1	UTSW	14	50866864	missense	probably benign	0.01
R2241:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2243:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2311:Tep1	UTSW	14	50833567	missense	possibly damaging	0.95
R2420:Tep1	UTSW	14	50834023	missense	probably benign
R2874:Tep1	UTSW	14	50850650	missense	possibly damaging	0.71
R3084:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3086:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3621:Tep1	UTSW	14	50829020	missense	probably damaging	0.99
R3815:Tep1	UTSW	14	50868315	missense	possibly damaging	0.71
R4124:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4125:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4127:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4134:Tep1	UTSW	14	50844860	missense	probably benign
R4152:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4153:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4191:Tep1	UTSW	14	50836806	missense	probably damaging	0.96
R4248:Tep1	UTSW	14	50862894	missense	possibly damaging	0.93
R4293:Tep1	UTSW	14	50846861	missense	probably benign
R4569:Tep1	UTSW	14	50824740	missense	probably benign	0.01
R4704:Tep1	UTSW	14	50837073	missense	probably benign	0.06
R4815:Tep1	UTSW	14	50841302	missense	probably damaging	0.99
R4978:Tep1	UTSW	14	50845434	missense	possibly damaging	0.93
R4989:Tep1	UTSW	14	50839000	missense	probably benign
R5022:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5057:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5063:Tep1	UTSW	14	50850627	missense	possibly damaging	0.86
R5118:Tep1	UTSW	14	50855587	splice site	probably null
R5128:Tep1	UTSW	14	50844279	makesense	probably null
R5149:Tep1	UTSW	14	50837398	nonsense	probably null
R5171:Tep1	UTSW	14	50824802	missense	probably benign	0.01
R5201:Tep1	UTSW	14	50868110	missense	probably benign	0.01
R5260:Tep1	UTSW	14	50838631	missense	probably benign
R5339:Tep1	UTSW	14	50844574	missense	probably damaging	0.99
R5384:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5385:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5386:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5594:Tep1	UTSW	14	50829882	missense	possibly damaging	0.86
R5639:Tep1	UTSW	14	50853605	missense	possibly damaging	0.85
R5749:Tep1	UTSW	14	50844072	missense	possibly damaging	0.59
R5756:Tep1	UTSW	14	50837379	critical splice donor site	probably null
R6013:Tep1	UTSW	14	50861048	missense	probably damaging	0.97
R6014:Tep1	UTSW	14	50847000	missense	probably benign	0.12
R6248:Tep1	UTSW	14	50830258	missense	probably damaging	0.98
R6264:Tep1	UTSW	14	50845513	missense	probably damaging	0.99
R6363:Tep1	UTSW	14	50824548	missense	probably benign	0.04
R6381:Tep1	UTSW	14	50845431	missense	probably damaging	0.99
R6462:Tep1	UTSW	14	50844379	missense	probably benign
R6942:Tep1	UTSW	14	50836737	missense	possibly damaging	0.85
R6951:Tep1	UTSW	14	50833913	critical splice donor site	probably null
R6979:Tep1	UTSW	14	50838637	missense	possibly damaging	0.93
R6999:Tep1	UTSW	14	50850705	missense	possibly damaging	0.86
R7099:Tep1	UTSW	14	50844487	intron	probably null
R7208:Tep1	UTSW	14	50824556	critical splice acceptor site	probably null
R7232:Tep1	UTSW	14	50844332	missense	unknown
R7249:Tep1	UTSW	14	50824275	missense	possibly damaging	0.86
R7325:Tep1	UTSW	14	50866038	missense	probably damaging	0.99
R7409:Tep1	UTSW	14	50866855	missense	possibly damaging	0.67
R7499:Tep1	UTSW	14	50853590	missense	probably damaging	0.99
R7542:Tep1	UTSW	14	50862491	nonsense	probably null
R7806:Tep1	UTSW	14	50836809	missense	possibly damaging	0.85
R7825:Tep1	UTSW	14	50843887	critical splice acceptor site	probably null
RF007:Tep1	UTSW	14	50860945	missense	possibly damaging	0.92
X0024:Tep1	UTSW	14	50827119	missense	possibly damaging	0.86
X0060:Tep1	UTSW	14	50836764	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- GCAGGAACCTTCTTTCCAAGGGTG -3'
(R):5'- CCCATACTGAGAACAGGCTCTGTTG -3'

Sequencing Primer
(F):5'- ccgcccactcccATGAC -3'
(R):5'- GAGAACAGGCTCTGTTGTTTTTAATC -3'

Posted On

2013-04-24