Mutagenetix > Incidental Mutation

Incidental Mutation 'R0373:Dsg3'

30657

Institutional Source

Beutler Lab

Gene Symbol

Dsg3

Ensembl Gene

ENSMUSG00000056632

Gene Name

desmoglein 3

Synonyms

MMRRC Submission

038579-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.610) question?

Stock #

R0373 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20510304-20541310 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 20539747 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 825 (D825A)

Ref Sequence

ENSEMBL: ENSMUSP00000064718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070892]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000070892
AA Change: D825A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: D825A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	70	155	3.9e-13	SMART
CA	179	265	2.36e-21	SMART
CA	288	382	1.55e-7	SMART
CA	409	493	6.15e-11	SMART
low complexity region	615	638	N/A	INTRINSIC
low complexity region	643	657	N/A	INTRINSIC
low complexity region	725	736	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.8%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	A	T	3: 138,173,582	L235Q	probably damaging	Het
Adam6b	T	A	12: 113,490,655	V364D	probably benign	Het
Akap13	T	C	7: 75,609,929	L767P	probably benign	Het
Akap13	T	A	7: 75,730,500	S2193T	probably damaging	Het
Anapc11	T	C	11: 120,605,377	V69A	probably benign	Het
Ankmy1	C	T	1: 92,896,190	R118Q	probably damaging	Het
Ankrd27	T	C	7: 35,638,053	S931P	probably benign	Het
Atp6v1c2	G	A	12: 17,288,168	R280C	probably damaging	Het
Bbs10	T	A	10: 111,300,052	I342N	probably damaging	Het
Calhm2	T	C	19: 47,132,950	D260G	possibly damaging	Het
Camk2a	A	G	18: 60,958,238	E264G	probably damaging	Het
Ccdc146	T	A	5: 21,319,545	M270L	probably benign	Het
Cdc16	A	G	8: 13,779,264	T517A	probably benign	Het
Ces1g	T	C	8: 93,331,193	H160R	probably benign	Het
Chst4	T	C	8: 110,030,394	N196S	probably damaging	Het
Ciz1	A	T	2: 32,367,467	N175Y	probably damaging	Het
Cyb5r4	G	A	9: 87,027,040	V57I	probably damaging	Het
Cyth3	A	G	5: 143,684,426		probably benign	Het
Def6	A	G	17: 28,220,180	E255G	probably damaging	Het
Dhtkd1	T	G	2: 5,911,870	Q665P	probably damaging	Het
Eif3m	T	C	2: 105,005,000	T242A	probably benign	Het
Emilin3	A	G	2: 160,909,817	F101L	probably benign	Het
Epha7	A	G	4: 28,935,700		probably null	Het
Fam205a1	T	C	4: 42,851,161	I332V	probably benign	Het
Fbxo45	A	T	16: 32,238,405	Y224N	probably damaging	Het
Fhod3	A	T	18: 25,090,104	M836L	possibly damaging	Het
Fut4	C	A	9: 14,751,210	V263F	probably damaging	Het
Ggt1	C	T	10: 75,579,270	T206M	probably benign	Het
Gls	T	C	1: 52,188,699	R79G	probably damaging	Het
Gm436	A	T	4: 144,686,220	M50K	possibly damaging	Het
Grhl1	T	C	12: 24,581,515	S156P	probably benign	Het
Ipo8	C	T	6: 148,775,042	S983N	probably benign	Het
Kcna7	C	T	7: 45,409,444	A385V	probably damaging	Het
Kpnb1	A	T	11: 97,185,090	L40Q	probably damaging	Het
Matn1	A	T	4: 130,950,106	S209C	probably damaging	Het
Mcc	A	G	18: 44,475,222	I501T	probably benign	Het
Mdp1	A	T	14: 55,659,375	F104L	probably damaging	Het
Mib2	A	T	4: 155,656,288	N626K	probably damaging	Het
Mrgprh	T	C	17: 12,876,956	S28P	possibly damaging	Het
Mup-ps23	T	A	4: 61,856,149		noncoding transcript	Het
Myh15	A	G	16: 49,182,959	T1794A	possibly damaging	Het
Myo18a	C	G	11: 77,821,042	P680A	probably benign	Het
Myom2	G	T	8: 15,098,419	D532Y	possibly damaging	Het
Ndufaf5	A	G	2: 140,170,881	N57S	probably benign	Het
Nectin3	C	T	16: 46,458,187	V282M	probably damaging	Het
Nup188	G	T	2: 30,330,988	D997Y	probably damaging	Het
Olfm3	T	C	3: 115,122,805	V462A	probably damaging	Het
Olfr1044	A	C	2: 86,171,706	F37C	probably damaging	Het
Olfr1225	A	T	2: 89,170,413	F266L	probably benign	Het
Olfr305	A	T	7: 86,363,805	C177*	probably null	Het
Opcml	A	G	9: 28,813,398	H164R	possibly damaging	Het
Pacrg	A	G	17: 10,403,418	I209T	probably damaging	Het
Pcf11	T	C	7: 92,661,215	M522V	probably benign	Het
Pck1	T	A	2: 173,153,390	M1K	probably null	Het
Pcm1	G	T	8: 41,276,111	E707*	probably null	Het
Pcsk5	G	A	19: 17,654,849	R318W	probably damaging	Het
Phf11d	A	T	14: 59,353,344	M188K	possibly damaging	Het
Ppip5k2	A	T	1: 97,740,537	C615*	probably null	Het
Prkdc	T	A	16: 15,791,927	S3132T	probably damaging	Het
Prl2c5	A	T	13: 13,183,024		probably benign	Het
Prpsap2	A	G	11: 61,741,000	I177T	possibly damaging	Het
Rad50	A	G	11: 53,650,519	S1297P	probably damaging	Het
Rasip1	T	A	7: 45,635,244	N678K	possibly damaging	Het
Rubcn	A	G	16: 32,835,980	S544P	probably damaging	Het
Rwdd2a	A	T	9: 86,574,400	T210S	possibly damaging	Het
Scd2	A	G	19: 44,303,040	D306G	probably damaging	Het
Sema3b	T	C	9: 107,602,918	N207S	probably benign	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Sipa1l2	C	A	8: 125,464,410	C947F	probably damaging	Het
Slc12a1	A	T	2: 125,226,031	T1013S	probably damaging	Het
Slc18a2	A	T	19: 59,287,367	I461L	probably benign	Het
Slc1a6	C	A	10: 78,801,922	Y427*	probably null	Het
Slc30a4	A	T	2: 122,689,399	I231K	probably damaging	Het
Sos1	G	T	17: 80,453,763	A168D	probably damaging	Het
Sptb	T	C	12: 76,621,371	S651G	probably benign	Het
Stk36	T	C	1: 74,633,620	L1007P	probably damaging	Het
Tek	A	T	4: 94,804,341	N229Y	probably damaging	Het
Tep1	A	G	14: 50,836,768	F1887L	possibly damaging	Het
Tet1	A	T	10: 62,878,209	C602*	probably null	Het
Tnfrsf19	A	G	14: 60,972,036	S262P	possibly damaging	Het
Trim5	T	C	7: 104,265,684	I393V	probably benign	Het
Trpm6	A	G	19: 18,853,587	E1272G	probably benign	Het
Ttc21b	A	T	2: 66,188,326	Y1246N	probably damaging	Het
Ttll3	T	A	6: 113,398,777	L151H	probably damaging	Het
U2surp	C	T	9: 95,484,443	V470I	probably benign	Het
Ubr1	A	T	2: 120,946,657	Y276N	probably benign	Het
Uggt1	A	G	1: 36,179,670	S59P	probably benign	Het
Unc45a	T	C	7: 80,326,344	T796A	probably damaging	Het
Unc5b	C	A	10: 60,778,940	V193F	possibly damaging	Het
Upp1	G	T	11: 9,129,590	M50I	probably benign	Het
Vps18	C	T	2: 119,293,905	R438C	probably damaging	Het
Zfp715	T	C	7: 43,299,336	Y400C	possibly damaging	Het
Zfp955b	T	C	17: 33,302,522	Y322H	probably benign	Het

Other mutations in Dsg3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Dsg3	APN	18	20539654	missense	probably damaging	1.00
IGL00697:Dsg3	APN	18	20524689	critical splice donor site	probably null
IGL00966:Dsg3	APN	18	20523607	missense	probably benign	0.02
IGL01352:Dsg3	APN	18	20523696	missense	probably benign	0.25
IGL01953:Dsg3	APN	18	20525304	missense	probably damaging	1.00
IGL02385:Dsg3	APN	18	20527714	missense	probably damaging	1.00
IGL02622:Dsg3	APN	18	20528947	splice site	probably benign
IGL02643:Dsg3	APN	18	20528955	missense	probably benign	0.00
IGL02740:Dsg3	APN	18	20527708	missense	possibly damaging	0.93
IGL03012:Dsg3	APN	18	20537243	critical splice acceptor site	probably null
IGL03026:Dsg3	APN	18	20536972	splice site	probably null
IGL03063:Dsg3	APN	18	20533368	splice site	probably benign
IGL03098:Dsg3	APN	18	20510365	utr 5 prime	probably benign
IGL03132:Dsg3	APN	18	20524596	missense	probably damaging	1.00
IGL03352:Dsg3	APN	18	20527632	missense	probably benign
P0035:Dsg3	UTSW	18	20539969	missense	probably benign	0.05
R0039:Dsg3	UTSW	18	20521484	missense	probably benign	0.36
R0099:Dsg3	UTSW	18	20540022	missense	probably benign	0.01
R0109:Dsg3	UTSW	18	20540134	missense	probably damaging	0.96
R0109:Dsg3	UTSW	18	20540134	missense	probably damaging	0.96
R0143:Dsg3	UTSW	18	20536825	missense	probably damaging	1.00
R0194:Dsg3	UTSW	18	20540142	missense	probably damaging	1.00
R0517:Dsg3	UTSW	18	20529025	missense	probably benign	0.06
R0521:Dsg3	UTSW	18	20527815	missense	possibly damaging	0.53
R1194:Dsg3	UTSW	18	20525220	missense	probably damaging	0.98
R1551:Dsg3	UTSW	18	20536918	missense	possibly damaging	0.84
R1762:Dsg3	UTSW	18	20539732	missense	probably damaging	1.00
R1957:Dsg3	UTSW	18	20522105	missense	probably damaging	1.00
R2061:Dsg3	UTSW	18	20527737	nonsense	probably null
R2071:Dsg3	UTSW	18	20536825	missense	probably damaging	1.00
R2513:Dsg3	UTSW	18	20523662	missense	possibly damaging	0.48
R2571:Dsg3	UTSW	18	20540005	missense	probably benign	0.01
R2945:Dsg3	UTSW	18	20539935	missense	probably benign
R2968:Dsg3	UTSW	18	20525225	missense	possibly damaging	0.75
R3906:Dsg3	UTSW	18	20538499	missense	probably damaging	1.00
R4616:Dsg3	UTSW	18	20531559	missense	probably benign
R4641:Dsg3	UTSW	18	20520558	missense	probably benign	0.28
R4685:Dsg3	UTSW	18	20539736	missense	probably benign	0.08
R5690:Dsg3	UTSW	18	20522051	missense	probably benign	0.01
R5786:Dsg3	UTSW	18	20521571	missense	possibly damaging	0.46
R5950:Dsg3	UTSW	18	20538529	missense	probably damaging	1.00
R6131:Dsg3	UTSW	18	20538512	missense	probably damaging	0.99
R6131:Dsg3	UTSW	18	20520477	splice site	probably null
R6243:Dsg3	UTSW	18	20539724	missense	probably damaging	1.00
R6315:Dsg3	UTSW	18	20524586	missense	probably benign	0.08
R6327:Dsg3	UTSW	18	20539870	missense	probably benign
R6418:Dsg3	UTSW	18	20523760	critical splice donor site	probably null
R6464:Dsg3	UTSW	18	20533526	missense	probably benign	0.00
R6497:Dsg3	UTSW	18	20537248	missense	probably benign	0.33
R6518:Dsg3	UTSW	18	20533422	missense	probably benign	0.23
R6551:Dsg3	UTSW	18	20539911	missense	unknown
R6685:Dsg3	UTSW	18	20520615	critical splice donor site	probably null
R6952:Dsg3	UTSW	18	20525159	missense	possibly damaging	0.77
R7357:Dsg3	UTSW	18	20539783	missense	probably damaging	1.00
R7385:Dsg3	UTSW	18	20540197	missense	possibly damaging	0.52
R7456:Dsg3	UTSW	18	20531363	missense	probably benign	0.17
R7506:Dsg3	UTSW	18	20533464	missense	probably benign	0.31
R7570:Dsg3	UTSW	18	20527780	missense	possibly damaging	0.95
R7980:Dsg3	UTSW	18	20531360	missense	probably benign	0.00
R8100:Dsg3	UTSW	18	20528971	missense	probably benign	0.08
R8147:Dsg3	UTSW	18	20540073	missense	probably benign
R8242:Dsg3	UTSW	18	20536923	missense	possibly damaging	0.93
R8415:Dsg3	UTSW	18	20523708	missense	probably damaging	1.00
R8494:Dsg3	UTSW	18	20540214	missense	probably benign	0.03
R8930:Dsg3	UTSW	18	20539661	missense	probably damaging	1.00
R8932:Dsg3	UTSW	18	20539661	missense	probably damaging	1.00
R8998:Dsg3	UTSW	18	20533627	missense	probably damaging	1.00
R8999:Dsg3	UTSW	18	20533627	missense	probably damaging	1.00
R9336:Dsg3	UTSW	18	20524685	missense	probably benign	0.19
R9498:Dsg3	UTSW	18	20525221	missense	probably damaging	0.98
R9598:Dsg3	UTSW	18	20539732	missense	probably damaging	1.00
R9601:Dsg3	UTSW	18	20533521	missense	probably damaging	1.00
R9748:Dsg3	UTSW	18	20539704	missense	possibly damaging	0.87
R9794:Dsg3	UTSW	18	20540097	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCACCTGTGTGGAGTACCCAGTG -3'
(R):5'- ACCTGTTAGAACCTGACTGAGGGAC -3'

Sequencing Primer
(F):5'- CAGCCTTGGGCTTTATGAACAG -3'
(R):5'- ACCTGACTGAGGGACTTCCATAG -3'

Posted On

2013-04-24