Incidental Mutation 'R0373:Dsg3'
ID30657
Institutional Source Beutler Lab
Gene Symbol Dsg3
Ensembl Gene ENSMUSG00000056632
Gene Namedesmoglein 3
Synonyms
MMRRC Submission 038579-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R0373 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20510304-20541310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 20539747 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 825 (D825A)
Ref Sequence ENSEMBL: ENSMUSP00000064718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070892]
Predicted Effect probably damaging
Transcript: ENSMUST00000070892
AA Change: D825A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: D825A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.9e-13 SMART
CA 179 265 2.36e-21 SMART
CA 288 382 1.55e-7 SMART
CA 409 493 6.15e-11 SMART
low complexity region 615 638 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A T 3: 138,173,582 L235Q probably damaging Het
Adam6b T A 12: 113,490,655 V364D probably benign Het
Akap13 T C 7: 75,609,929 L767P probably benign Het
Akap13 T A 7: 75,730,500 S2193T probably damaging Het
Anapc11 T C 11: 120,605,377 V69A probably benign Het
Ankmy1 C T 1: 92,896,190 R118Q probably damaging Het
Ankrd27 T C 7: 35,638,053 S931P probably benign Het
Atp6v1c2 G A 12: 17,288,168 R280C probably damaging Het
Bbs10 T A 10: 111,300,052 I342N probably damaging Het
Calhm2 T C 19: 47,132,950 D260G possibly damaging Het
Camk2a A G 18: 60,958,238 E264G probably damaging Het
Ccdc146 T A 5: 21,319,545 M270L probably benign Het
Cdc16 A G 8: 13,779,264 T517A probably benign Het
Ces1g T C 8: 93,331,193 H160R probably benign Het
Chst4 T C 8: 110,030,394 N196S probably damaging Het
Ciz1 A T 2: 32,367,467 N175Y probably damaging Het
Cyb5r4 G A 9: 87,027,040 V57I probably damaging Het
Cyth3 A G 5: 143,684,426 probably benign Het
Def6 A G 17: 28,220,180 E255G probably damaging Het
Dhtkd1 T G 2: 5,911,870 Q665P probably damaging Het
Eif3m T C 2: 105,005,000 T242A probably benign Het
Emilin3 A G 2: 160,909,817 F101L probably benign Het
Epha7 A G 4: 28,935,700 probably null Het
Fam205a1 T C 4: 42,851,161 I332V probably benign Het
Fbxo45 A T 16: 32,238,405 Y224N probably damaging Het
Fhod3 A T 18: 25,090,104 M836L possibly damaging Het
Fut4 C A 9: 14,751,210 V263F probably damaging Het
Ggt1 C T 10: 75,579,270 T206M probably benign Het
Gls T C 1: 52,188,699 R79G probably damaging Het
Gm436 A T 4: 144,686,220 M50K possibly damaging Het
Grhl1 T C 12: 24,581,515 S156P probably benign Het
Ipo8 C T 6: 148,775,042 S983N probably benign Het
Kcna7 C T 7: 45,409,444 A385V probably damaging Het
Kpnb1 A T 11: 97,185,090 L40Q probably damaging Het
Matn1 A T 4: 130,950,106 S209C probably damaging Het
Mcc A G 18: 44,475,222 I501T probably benign Het
Mdp1 A T 14: 55,659,375 F104L probably damaging Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Mrgprh T C 17: 12,876,956 S28P possibly damaging Het
Mup-ps23 T A 4: 61,856,149 noncoding transcript Het
Myh15 A G 16: 49,182,959 T1794A possibly damaging Het
Myo18a C G 11: 77,821,042 P680A probably benign Het
Myom2 G T 8: 15,098,419 D532Y possibly damaging Het
Ndufaf5 A G 2: 140,170,881 N57S probably benign Het
Nectin3 C T 16: 46,458,187 V282M probably damaging Het
Nup188 G T 2: 30,330,988 D997Y probably damaging Het
Olfm3 T C 3: 115,122,805 V462A probably damaging Het
Olfr1044 A C 2: 86,171,706 F37C probably damaging Het
Olfr1225 A T 2: 89,170,413 F266L probably benign Het
Olfr305 A T 7: 86,363,805 C177* probably null Het
Opcml A G 9: 28,813,398 H164R possibly damaging Het
Pacrg A G 17: 10,403,418 I209T probably damaging Het
Pcf11 T C 7: 92,661,215 M522V probably benign Het
Pck1 T A 2: 173,153,390 M1K probably null Het
Pcm1 G T 8: 41,276,111 E707* probably null Het
Pcsk5 G A 19: 17,654,849 R318W probably damaging Het
Phf11d A T 14: 59,353,344 M188K possibly damaging Het
Ppip5k2 A T 1: 97,740,537 C615* probably null Het
Prkdc T A 16: 15,791,927 S3132T probably damaging Het
Prl2c5 A T 13: 13,183,024 probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Rad50 A G 11: 53,650,519 S1297P probably damaging Het
Rasip1 T A 7: 45,635,244 N678K possibly damaging Het
Rubcn A G 16: 32,835,980 S544P probably damaging Het
Rwdd2a A T 9: 86,574,400 T210S possibly damaging Het
Scd2 A G 19: 44,303,040 D306G probably damaging Het
Sema3b T C 9: 107,602,918 N207S probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sipa1l2 C A 8: 125,464,410 C947F probably damaging Het
Slc12a1 A T 2: 125,226,031 T1013S probably damaging Het
Slc18a2 A T 19: 59,287,367 I461L probably benign Het
Slc1a6 C A 10: 78,801,922 Y427* probably null Het
Slc30a4 A T 2: 122,689,399 I231K probably damaging Het
Sos1 G T 17: 80,453,763 A168D probably damaging Het
Sptb T C 12: 76,621,371 S651G probably benign Het
Stk36 T C 1: 74,633,620 L1007P probably damaging Het
Tek A T 4: 94,804,341 N229Y probably damaging Het
Tep1 A G 14: 50,836,768 F1887L possibly damaging Het
Tet1 A T 10: 62,878,209 C602* probably null Het
Tnfrsf19 A G 14: 60,972,036 S262P possibly damaging Het
Trim5 T C 7: 104,265,684 I393V probably benign Het
Trpm6 A G 19: 18,853,587 E1272G probably benign Het
Ttc21b A T 2: 66,188,326 Y1246N probably damaging Het
Ttll3 T A 6: 113,398,777 L151H probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Ubr1 A T 2: 120,946,657 Y276N probably benign Het
Uggt1 A G 1: 36,179,670 S59P probably benign Het
Unc45a T C 7: 80,326,344 T796A probably damaging Het
Unc5b C A 10: 60,778,940 V193F possibly damaging Het
Upp1 G T 11: 9,129,590 M50I probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp715 T C 7: 43,299,336 Y400C possibly damaging Het
Zfp955b T C 17: 33,302,522 Y322H probably benign Het
Other mutations in Dsg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Dsg3 APN 18 20539654 missense probably damaging 1.00
IGL00697:Dsg3 APN 18 20524689 critical splice donor site probably null
IGL00966:Dsg3 APN 18 20523607 missense probably benign 0.02
IGL01352:Dsg3 APN 18 20523696 missense probably benign 0.25
IGL01953:Dsg3 APN 18 20525304 missense probably damaging 1.00
IGL02385:Dsg3 APN 18 20527714 missense probably damaging 1.00
IGL02622:Dsg3 APN 18 20528947 splice site probably benign
IGL02643:Dsg3 APN 18 20528955 missense probably benign 0.00
IGL02740:Dsg3 APN 18 20527708 missense possibly damaging 0.93
IGL03012:Dsg3 APN 18 20537243 critical splice acceptor site probably null
IGL03026:Dsg3 APN 18 20536972 splice site probably null
IGL03063:Dsg3 APN 18 20533368 splice site probably benign
IGL03098:Dsg3 APN 18 20510365 utr 5 prime probably benign
IGL03132:Dsg3 APN 18 20524596 missense probably damaging 1.00
IGL03352:Dsg3 APN 18 20527632 missense probably benign
P0035:Dsg3 UTSW 18 20539969 missense probably benign 0.05
R0039:Dsg3 UTSW 18 20521484 missense probably benign 0.36
R0099:Dsg3 UTSW 18 20540022 missense probably benign 0.01
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0143:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R0194:Dsg3 UTSW 18 20540142 missense probably damaging 1.00
R0517:Dsg3 UTSW 18 20529025 missense probably benign 0.06
R0521:Dsg3 UTSW 18 20527815 missense possibly damaging 0.53
R1194:Dsg3 UTSW 18 20525220 missense probably damaging 0.98
R1551:Dsg3 UTSW 18 20536918 missense possibly damaging 0.84
R1762:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R1957:Dsg3 UTSW 18 20522105 missense probably damaging 1.00
R2061:Dsg3 UTSW 18 20527737 nonsense probably null
R2071:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R2513:Dsg3 UTSW 18 20523662 missense possibly damaging 0.48
R2571:Dsg3 UTSW 18 20540005 missense probably benign 0.01
R2945:Dsg3 UTSW 18 20539935 missense probably benign
R2968:Dsg3 UTSW 18 20525225 missense possibly damaging 0.75
R3906:Dsg3 UTSW 18 20538499 missense probably damaging 1.00
R4616:Dsg3 UTSW 18 20531559 missense probably benign
R4641:Dsg3 UTSW 18 20520558 missense probably benign 0.28
R4685:Dsg3 UTSW 18 20539736 missense probably benign 0.08
R5690:Dsg3 UTSW 18 20522051 missense probably benign 0.01
R5786:Dsg3 UTSW 18 20521571 missense possibly damaging 0.46
R5950:Dsg3 UTSW 18 20538529 missense probably damaging 1.00
R6131:Dsg3 UTSW 18 20538512 missense probably damaging 0.99
R6131:Dsg3 UTSW 18 20520477 splice site probably null
R6243:Dsg3 UTSW 18 20539724 missense probably damaging 1.00
R6315:Dsg3 UTSW 18 20524586 missense probably benign 0.08
R6327:Dsg3 UTSW 18 20539870 missense probably benign
R6418:Dsg3 UTSW 18 20523760 critical splice donor site probably null
R6464:Dsg3 UTSW 18 20533526 missense probably benign 0.00
R6497:Dsg3 UTSW 18 20537248 missense probably benign 0.33
R6518:Dsg3 UTSW 18 20533422 missense probably benign 0.23
R6551:Dsg3 UTSW 18 20539911 missense unknown
R6685:Dsg3 UTSW 18 20520615 critical splice donor site probably null
R6952:Dsg3 UTSW 18 20525159 missense possibly damaging 0.77
R7357:Dsg3 UTSW 18 20539783 missense probably damaging 1.00
R7385:Dsg3 UTSW 18 20540197 missense possibly damaging 0.52
R7456:Dsg3 UTSW 18 20531363 missense probably benign 0.17
R7506:Dsg3 UTSW 18 20533464 missense probably benign 0.31
R7570:Dsg3 UTSW 18 20527780 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATCACCTGTGTGGAGTACCCAGTG -3'
(R):5'- ACCTGTTAGAACCTGACTGAGGGAC -3'

Sequencing Primer
(F):5'- CAGCCTTGGGCTTTATGAACAG -3'
(R):5'- ACCTGACTGAGGGACTTCCATAG -3'
Posted On2013-04-24