Incidental Mutation 'R0373:Trpm6'
ID 30662
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 038579-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0373 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 18727347-18869875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18830951 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1272 (E1272G)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: E1272G

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: E1272G

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A T 3: 137,879,343 (GRCm39) L235Q probably damaging Het
Aadacl4fm4 A T 4: 144,412,790 (GRCm39) M50K possibly damaging Het
Adam6b T A 12: 113,454,275 (GRCm39) V364D probably benign Het
Akap13 T C 7: 75,259,677 (GRCm39) L767P probably benign Het
Akap13 T A 7: 75,380,248 (GRCm39) S2193T probably damaging Het
Anapc11 T C 11: 120,496,203 (GRCm39) V69A probably benign Het
Ankmy1 C T 1: 92,823,912 (GRCm39) R118Q probably damaging Het
Ankrd27 T C 7: 35,337,478 (GRCm39) S931P probably benign Het
Atp6v1c2 G A 12: 17,338,169 (GRCm39) R280C probably damaging Het
Bbs10 T A 10: 111,135,913 (GRCm39) I342N probably damaging Het
Calhm2 T C 19: 47,121,389 (GRCm39) D260G possibly damaging Het
Camk2a A G 18: 61,091,310 (GRCm39) E264G probably damaging Het
Ccdc146 T A 5: 21,524,543 (GRCm39) M270L probably benign Het
Cdc16 A G 8: 13,829,264 (GRCm39) T517A probably benign Het
Ces1g T C 8: 94,057,821 (GRCm39) H160R probably benign Het
Chst4 T C 8: 110,757,026 (GRCm39) N196S probably damaging Het
Ciz1 A T 2: 32,257,479 (GRCm39) N175Y probably damaging Het
Cyb5r4 G A 9: 86,909,093 (GRCm39) V57I probably damaging Het
Cyth3 A G 5: 143,670,181 (GRCm39) probably benign Het
Def6 A G 17: 28,439,154 (GRCm39) E255G probably damaging Het
Dhtkd1 T G 2: 5,916,681 (GRCm39) Q665P probably damaging Het
Dsg3 A C 18: 20,672,804 (GRCm39) D825A probably damaging Het
Eif3m T C 2: 104,835,345 (GRCm39) T242A probably benign Het
Emilin3 A G 2: 160,751,737 (GRCm39) F101L probably benign Het
Epha7 A G 4: 28,935,700 (GRCm39) probably null Het
Fbxo45 A T 16: 32,057,223 (GRCm39) Y224N probably damaging Het
Fhod3 A T 18: 25,223,161 (GRCm39) M836L possibly damaging Het
Fut4 C A 9: 14,662,506 (GRCm39) V263F probably damaging Het
Ggt1 C T 10: 75,415,104 (GRCm39) T206M probably benign Het
Gls T C 1: 52,227,858 (GRCm39) R79G probably damaging Het
Grhl1 T C 12: 24,631,514 (GRCm39) S156P probably benign Het
Ipo8 C T 6: 148,676,540 (GRCm39) S983N probably benign Het
Kcna7 C T 7: 45,058,868 (GRCm39) A385V probably damaging Het
Kpnb1 A T 11: 97,075,916 (GRCm39) L40Q probably damaging Het
Matn1 A T 4: 130,677,417 (GRCm39) S209C probably damaging Het
Mcc A G 18: 44,608,289 (GRCm39) I501T probably benign Het
Mdp1 A T 14: 55,896,832 (GRCm39) F104L probably damaging Het
Mib2 A T 4: 155,740,745 (GRCm39) N626K probably damaging Het
Mrgprh T C 17: 13,095,843 (GRCm39) S28P possibly damaging Het
Mup-ps23 T A 4: 61,774,386 (GRCm39) noncoding transcript Het
Myh15 A G 16: 49,003,322 (GRCm39) T1794A possibly damaging Het
Myo18a C G 11: 77,711,868 (GRCm39) P680A probably benign Het
Myom2 G T 8: 15,148,419 (GRCm39) D532Y possibly damaging Het
Ndufaf5 A G 2: 140,012,801 (GRCm39) N57S probably benign Het
Nectin3 C T 16: 46,278,550 (GRCm39) V282M probably damaging Het
Nup188 G T 2: 30,221,000 (GRCm39) D997Y probably damaging Het
Olfm3 T C 3: 114,916,454 (GRCm39) V462A probably damaging Het
Opcml A G 9: 28,724,694 (GRCm39) H164R possibly damaging Het
Or14a259 A T 7: 86,013,013 (GRCm39) C177* probably null Het
Or4c120 A T 2: 89,000,757 (GRCm39) F266L probably benign Het
Or8u9 A C 2: 86,002,050 (GRCm39) F37C probably damaging Het
Pacrg A G 17: 10,622,347 (GRCm39) I209T probably damaging Het
Pcf11 T C 7: 92,310,423 (GRCm39) M522V probably benign Het
Pck1 T A 2: 172,995,183 (GRCm39) M1K probably null Het
Pcm1 G T 8: 41,729,148 (GRCm39) E707* probably null Het
Pcsk5 G A 19: 17,632,213 (GRCm39) R318W probably damaging Het
Phf11d A T 14: 59,590,793 (GRCm39) M188K possibly damaging Het
Ppip5k2 A T 1: 97,668,262 (GRCm39) C615* probably null Het
Prkdc T A 16: 15,609,791 (GRCm39) S3132T probably damaging Het
Prl2c5 A T 13: 13,357,609 (GRCm39) probably benign Het
Prpsap2 A G 11: 61,631,826 (GRCm39) I177T possibly damaging Het
Rad50 A G 11: 53,541,346 (GRCm39) S1297P probably damaging Het
Rasip1 T A 7: 45,284,668 (GRCm39) N678K possibly damaging Het
Rubcn A G 16: 32,656,350 (GRCm39) S544P probably damaging Het
Rwdd2a A T 9: 86,456,453 (GRCm39) T210S possibly damaging Het
Scd2 A G 19: 44,291,479 (GRCm39) D306G probably damaging Het
Sema3b T C 9: 107,480,117 (GRCm39) N207S probably benign Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Sipa1l2 C A 8: 126,191,149 (GRCm39) C947F probably damaging Het
Slc12a1 A T 2: 125,067,951 (GRCm39) T1013S probably damaging Het
Slc18a2 A T 19: 59,275,799 (GRCm39) I461L probably benign Het
Slc1a6 C A 10: 78,637,756 (GRCm39) Y427* probably null Het
Slc30a4 A T 2: 122,531,319 (GRCm39) I231K probably damaging Het
Sos1 G T 17: 80,761,192 (GRCm39) A168D probably damaging Het
Spata31f1a T C 4: 42,851,161 (GRCm39) I332V probably benign Het
Sptb T C 12: 76,668,145 (GRCm39) S651G probably benign Het
Stk36 T C 1: 74,672,779 (GRCm39) L1007P probably damaging Het
Tek A T 4: 94,692,578 (GRCm39) N229Y probably damaging Het
Tep1 A G 14: 51,074,225 (GRCm39) F1887L possibly damaging Het
Tet1 A T 10: 62,713,988 (GRCm39) C602* probably null Het
Tnfrsf19 A G 14: 61,209,485 (GRCm39) S262P possibly damaging Het
Trim5 T C 7: 103,914,891 (GRCm39) I393V probably benign Het
Ttc21b A T 2: 66,018,670 (GRCm39) Y1246N probably damaging Het
Ttll3 T A 6: 113,375,738 (GRCm39) L151H probably damaging Het
U2surp C T 9: 95,366,496 (GRCm39) V470I probably benign Het
Ubr1 A T 2: 120,777,138 (GRCm39) Y276N probably benign Het
Uggt1 A G 1: 36,218,751 (GRCm39) S59P probably benign Het
Unc45a T C 7: 79,976,092 (GRCm39) T796A probably damaging Het
Unc5b C A 10: 60,614,719 (GRCm39) V193F possibly damaging Het
Upp1 G T 11: 9,079,590 (GRCm39) M50I probably benign Het
Vps18 C T 2: 119,124,386 (GRCm39) R438C probably damaging Het
Zfp715 T C 7: 42,948,760 (GRCm39) Y400C possibly damaging Het
Zfp955b T C 17: 33,521,496 (GRCm39) Y322H probably benign Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,761,272 (GRCm39) splice site probably benign
IGL00862:Trpm6 APN 19 18,804,892 (GRCm39) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,855,015 (GRCm39) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,803,158 (GRCm39) nonsense probably null
IGL01451:Trpm6 APN 19 18,786,933 (GRCm39) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,773,894 (GRCm39) nonsense probably null
IGL01995:Trpm6 APN 19 18,807,691 (GRCm39) splice site probably benign
IGL02092:Trpm6 APN 19 18,749,695 (GRCm39) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,809,903 (GRCm39) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,831,427 (GRCm39) missense probably benign
IGL02329:Trpm6 APN 19 18,831,581 (GRCm39) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,755,874 (GRCm39) splice site probably benign
IGL02402:Trpm6 APN 19 18,764,120 (GRCm39) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,804,762 (GRCm39) nonsense probably null
IGL02457:Trpm6 APN 19 18,803,155 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,779,571 (GRCm39) splice site probably benign
IGL02705:Trpm6 APN 19 18,754,097 (GRCm39) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,787,016 (GRCm39) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,807,376 (GRCm39) splice site probably benign
IGL02818:Trpm6 APN 19 18,843,621 (GRCm39) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,790,846 (GRCm39) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,815,381 (GRCm39) nonsense probably null
IGL03193:Trpm6 APN 19 18,803,236 (GRCm39) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,764,143 (GRCm39) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,796,483 (GRCm39) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,796,545 (GRCm39) missense probably benign
IGL03245:Trpm6 APN 19 18,855,065 (GRCm39) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,815,446 (GRCm39) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,790,850 (GRCm39) missense probably benign
P0043:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,803,166 (GRCm39) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,764,119 (GRCm39) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,809,957 (GRCm39) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,796,558 (GRCm39) splice site probably null
R0267:Trpm6 UTSW 19 18,800,742 (GRCm39) missense probably benign
R0350:Trpm6 UTSW 19 18,861,321 (GRCm39) splice site probably null
R0393:Trpm6 UTSW 19 18,756,008 (GRCm39) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,760,389 (GRCm39) splice site probably benign
R0505:Trpm6 UTSW 19 18,851,266 (GRCm39) splice site probably benign
R0526:Trpm6 UTSW 19 18,770,240 (GRCm39) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,849,585 (GRCm39) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,803,226 (GRCm39) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,815,451 (GRCm39) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,773,862 (GRCm39) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,773,859 (GRCm39) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,853,295 (GRCm39) missense probably benign
R1558:Trpm6 UTSW 19 18,764,192 (GRCm39) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,804,888 (GRCm39) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,854,995 (GRCm39) missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18,833,581 (GRCm39) missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18,804,931 (GRCm39) missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18,869,363 (GRCm39) splice site probably null
R1840:Trpm6 UTSW 19 18,843,631 (GRCm39) missense probably benign 0.21
R1991:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,831,629 (GRCm39) missense probably benign
R2073:Trpm6 UTSW 19 18,853,406 (GRCm39) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,855,103 (GRCm39) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,803,116 (GRCm39) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,790,714 (GRCm39) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,769,454 (GRCm39) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,831,795 (GRCm39) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,749,757 (GRCm39) nonsense probably null
R3779:Trpm6 UTSW 19 18,853,403 (GRCm39) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,809,921 (GRCm39) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,804,889 (GRCm39) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,773,864 (GRCm39) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,809,841 (GRCm39) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,809,961 (GRCm39) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,803,236 (GRCm39) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,831,564 (GRCm39) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,853,428 (GRCm39) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,790,857 (GRCm39) missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18,845,345 (GRCm39) missense probably benign 0.00
R4814:Trpm6 UTSW 19 18,839,576 (GRCm39) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,764,124 (GRCm39) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,790,828 (GRCm39) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,807,297 (GRCm39) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,807,571 (GRCm39) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,830,968 (GRCm39) missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18,830,981 (GRCm39) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,764,183 (GRCm39) missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18,833,539 (GRCm39) missense probably benign 0.04
R5955:Trpm6 UTSW 19 18,869,383 (GRCm39) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6105:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6211:Trpm6 UTSW 19 18,760,492 (GRCm39) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,831,655 (GRCm39) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,831,472 (GRCm39) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,807,354 (GRCm39) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,815,406 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,866,384 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,773,803 (GRCm39) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,807,661 (GRCm39) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,760,527 (GRCm39) missense probably benign
R7103:Trpm6 UTSW 19 18,790,911 (GRCm39) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,831,397 (GRCm39) nonsense probably null
R7128:Trpm6 UTSW 19 18,789,137 (GRCm39) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,854,150 (GRCm39) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,755,949 (GRCm39) missense probably benign 0.13
R7305:Trpm6 UTSW 19 18,853,455 (GRCm39) missense probably benign 0.30
R7498:Trpm6 UTSW 19 18,853,484 (GRCm39) missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18,756,029 (GRCm39) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,809,945 (GRCm39) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,845,325 (GRCm39) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,853,377 (GRCm39) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,831,613 (GRCm39) missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18,804,772 (GRCm39) missense probably benign 0.03
R7747:Trpm6 UTSW 19 18,727,409 (GRCm39) splice site probably null
R7807:Trpm6 UTSW 19 18,807,220 (GRCm39) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,792,605 (GRCm39) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,754,074 (GRCm39) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,831,654 (GRCm39) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,853,474 (GRCm39) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,756,023 (GRCm39) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,792,714 (GRCm39) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,770,226 (GRCm39) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,789,154 (GRCm39) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,851,225 (GRCm39) missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18,831,332 (GRCm39) missense probably benign 0.39
R8413:Trpm6 UTSW 19 18,809,849 (GRCm39) missense probably benign 0.00
R8534:Trpm6 UTSW 19 18,869,459 (GRCm39) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,815,366 (GRCm39) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,792,799 (GRCm39) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,810,016 (GRCm39) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,761,264 (GRCm39) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,755,978 (GRCm39) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,764,123 (GRCm39) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,853,394 (GRCm39) nonsense probably null
R9564:Trpm6 UTSW 19 18,851,240 (GRCm39) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,790,846 (GRCm39) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,869,466 (GRCm39) missense probably benign
R9721:Trpm6 UTSW 19 18,807,336 (GRCm39) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,800,766 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAGCAGTGCCTTAGCTGTCACC -3'
(R):5'- AAATCCCAGAAGCCGTTGTCCTC -3'

Sequencing Primer
(F):5'- CGTATCTTCACCATTAGGGTATCAG -3'
(R):5'- AGAAGCCGTTGTCCTCTGTTC -3'
Posted On 2013-04-24