Incidental Mutation 'R0375:Carf'
ID30668
Institutional Source Beutler Lab
Gene Symbol Carf
Ensembl Gene ENSMUSG00000026017
Gene Namecalcium response factor
SynonymsAls2cr8
MMRRC Submission 038581-MU
Accession Numbers

Genbank: NM_139150; MGI: 2182269

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0375 (G1)
Quality Score200
Status Validated
Chromosome1
Chromosomal Location60098247-60153953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60144002 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 386 (V386A)
Ref Sequence ENSEMBL: ENSMUSP00000027171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027171] [ENSMUST00000130075] [ENSMUST00000180952] [ENSMUST00000186107] [ENSMUST00000187978]
Predicted Effect probably damaging
Transcript: ENSMUST00000027171
AA Change: V386A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027171
Gene: ENSMUSG00000026017
AA Change: V386A

DomainStartEndE-ValueType
Pfam:ALS2CR8 227 457 6.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130075
Predicted Effect probably benign
Transcript: ENSMUST00000132949
Predicted Effect probably damaging
Transcript: ENSMUST00000180952
AA Change: V421A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137825
Gene: ENSMUSG00000026017
AA Change: V421A

DomainStartEndE-ValueType
Pfam:ALS2CR8 224 458 1.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186107
SMART Domains Protein: ENSMUSP00000139554
Gene: ENSMUSG00000026017

DomainStartEndE-ValueType
low complexity region 239 255 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186779
Predicted Effect probably damaging
Transcript: ENSMUST00000187978
AA Change: V421A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141169
Gene: ENSMUSG00000026017
AA Change: V421A

DomainStartEndE-ValueType
Pfam:ALS2CR8 224 458 1.2e-64 PFAM
Meta Mutation Damage Score 0.3639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele have aberrant learning and memory. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,046,252 T4707I probably damaging Het
5730522E02Rik T A 11: 25,769,092 Y17F unknown Het
Aars2 A G 17: 45,514,550 D313G probably damaging Het
Abca9 A T 11: 110,115,447 D1277E probably benign Het
Adgrl1 G T 8: 83,934,901 A981S probably damaging Het
Aff3 T G 1: 38,204,940 K917Q possibly damaging Het
BC049715 A T 6: 136,839,996 H78L probably benign Het
Cacna1g C A 11: 94,411,054 A2027S possibly damaging Het
Camk1g G A 1: 193,356,401 probably benign Het
Cd46 A G 1: 195,086,164 S82P probably benign Het
Clic5 A G 17: 44,270,623 E180G possibly damaging Het
Col27a1 A G 4: 63,225,661 T529A probably benign Het
Col7a1 C T 9: 108,980,237 R2627C unknown Het
Cuzd1 G A 7: 131,311,908 probably benign Het
Cwc27 T C 13: 104,807,823 D50G possibly damaging Het
Dhx38 A G 8: 109,555,181 V735A possibly damaging Het
Dhx57 T G 17: 80,258,121 E834A probably damaging Het
Dsg4 A G 18: 20,470,879 D801G probably damaging Het
Dtx1 T C 5: 120,681,399 E578G probably damaging Het
F830016B08Rik A T 18: 60,300,193 H116L probably damaging Het
Fam208b A G 13: 3,596,842 V61A possibly damaging Het
Fbxw18 T C 9: 109,688,839 I360V possibly damaging Het
Fignl2 G A 15: 101,054,093 P103S probably benign Het
Frmpd1 A G 4: 45,284,196 T1006A probably benign Het
Ggnbp2 G T 11: 84,836,374 C545* probably null Het
Gm3336 A G 8: 70,718,645 probably benign Het
Gpr37 T C 6: 25,669,291 N518S probably benign Het
Hbs1l T A 10: 21,342,541 D312E possibly damaging Het
Hoxd10 C A 2: 74,692,720 S247R probably benign Het
Ifnb1 A T 4: 88,522,744 F11I probably benign Het
Marf1 T C 16: 14,151,320 probably benign Het
Myo1f T A 17: 33,601,956 V879E probably benign Het
Naip1 A G 13: 100,409,148 F1291L probably benign Het
Nckap1l A G 15: 103,474,159 E529G probably damaging Het
Npm3 T C 19: 45,748,229 E157G probably damaging Het
Olfr1200 T A 2: 88,767,641 T225S possibly damaging Het
Olfr1240 G T 2: 89,439,396 N294K probably benign Het
Olfr248 A G 1: 174,391,209 T47A probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Ppp6r1 A G 7: 4,633,287 V768A probably benign Het
Prrc1 A G 18: 57,362,492 T14A probably damaging Het
Ranbp2 T C 10: 58,477,283 L1275P probably damaging Het
Rnf214 C A 9: 45,899,823 V181F probably damaging Het
Ror2 T C 13: 53,132,004 N58S probably damaging Het
Selplg G A 5: 113,820,008 T79I probably damaging Het
Setd1b G A 5: 123,157,437 G1023S unknown Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Skint5 A G 4: 113,705,596 V803A unknown Het
Slc25a46 T C 18: 31,583,266 I394M possibly damaging Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Spag17 C A 3: 100,027,590 T704K probably benign Het
Tas2r144 T A 6: 42,216,124 M266K possibly damaging Het
Tbc1d31 T A 15: 57,955,350 L783H probably benign Het
Tbck C A 3: 132,751,232 probably benign Het
Vcan A G 13: 89,691,275 V2050A probably damaging Het
Vmn1r70 T A 7: 10,634,060 N158K probably damaging Het
Vmn2r103 T A 17: 19,792,859 Y81N probably benign Het
Vmn2r103 A G 17: 19,793,464 T173A probably benign Het
Ylpm1 T G 12: 85,014,980 S552A unknown Het
Zdhhc17 A T 10: 110,982,106 Y58* probably null Het
Other mutations in Carf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Carf APN 1 60124842 splice site probably benign
IGL00730:Carf APN 1 60147418 nonsense probably null
IGL00792:Carf APN 1 60126009 missense possibly damaging 0.73
IGL00913:Carf APN 1 60147955 missense probably benign 0.20
IGL01487:Carf APN 1 60109379 missense probably damaging 1.00
IGL02214:Carf APN 1 60148081 missense probably damaging 1.00
IGL03258:Carf APN 1 60109229 missense possibly damaging 0.93
IGL03285:Carf APN 1 60146154 missense probably damaging 1.00
3-1:Carf UTSW 1 60141468 missense possibly damaging 0.93
PIT4283001:Carf UTSW 1 60128002 missense probably benign 0.32
R0465:Carf UTSW 1 60131983 missense probably damaging 1.00
R0591:Carf UTSW 1 60125914 splice site probably benign
R1158:Carf UTSW 1 60147839 missense probably benign 0.22
R1433:Carf UTSW 1 60124858 missense probably damaging 1.00
R1464:Carf UTSW 1 60125906 splice site probably benign
R1467:Carf UTSW 1 60127993 missense possibly damaging 0.58
R1467:Carf UTSW 1 60127993 missense possibly damaging 0.58
R1546:Carf UTSW 1 60126036 critical splice donor site probably null
R1801:Carf UTSW 1 60141505 missense possibly damaging 0.60
R1977:Carf UTSW 1 60146136 missense probably damaging 1.00
R2086:Carf UTSW 1 60109411 missense probably damaging 1.00
R2163:Carf UTSW 1 60147486 splice site probably benign
R2198:Carf UTSW 1 60141484 missense probably damaging 1.00
R2238:Carf UTSW 1 60148034 missense probably benign
R2981:Carf UTSW 1 60139232 missense probably damaging 1.00
R4090:Carf UTSW 1 60136347 missense possibly damaging 0.94
R4573:Carf UTSW 1 60148112 missense probably benign 0.39
R4737:Carf UTSW 1 60109318 missense probably benign 0.00
R4906:Carf UTSW 1 60141367 missense probably damaging 1.00
R4965:Carf UTSW 1 60150637 missense probably damaging 0.99
R5080:Carf UTSW 1 60150613 missense probably damaging 0.98
R5184:Carf UTSW 1 60108174 missense probably damaging 0.99
R5949:Carf UTSW 1 60139313 missense probably damaging 1.00
R6135:Carf UTSW 1 60147963 missense probably damaging 1.00
R6346:Carf UTSW 1 60141540 nonsense probably null
R6886:Carf UTSW 1 60136254 splice site probably null
R7115:Carf UTSW 1 60148150 missense probably damaging 1.00
R7228:Carf UTSW 1 60109394 missense probably damaging 0.99
R7459:Carf UTSW 1 60128039 missense possibly damaging 0.93
R7755:Carf UTSW 1 60148055 missense probably benign 0.00
R7809:Carf UTSW 1 60144067 missense probably damaging 0.98
R8053:Carf UTSW 1 60128038 missense probably benign 0.42
Z1177:Carf UTSW 1 60136262 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTTTGAACCAGTGAAACAGCACC -3'
(R):5'- ACAGGAGCTGAGATGCTCTAATGAGAC -3'

Sequencing Primer
(F):5'- AACCTGTGTGAATTCTATTGCC -3'
(R):5'- TGCTCTAATGAGACAAAGAAGTGG -3'
Posted On2013-04-24