Incidental Mutation 'R0375:Olfr248'
ID30669
Institutional Source Beutler Lab
Gene Symbol Olfr248
Ensembl Gene ENSMUSG00000059503
Gene Nameolfactory receptor 248
SynonymsGA_x6K02T2P20D-20771141-20770212, GA_x6K02T2MFC0-1145-1312, MOR267-7, Olfr415
MMRRC Submission 038581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0375 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174391046-174392055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174391209 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 47 (T47A)
Ref Sequence ENSEMBL: ENSMUSP00000074799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075329]
Predicted Effect probably damaging
Transcript: ENSMUST00000075329
AA Change: T47A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074799
Gene: ENSMUSG00000059503
AA Change: T47A

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.2e-40 PFAM
Pfam:7tm_1 39 303 7.5e-22 PFAM
Meta Mutation Damage Score 0.2296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,046,252 T4707I probably damaging Het
5730522E02Rik T A 11: 25,769,092 Y17F unknown Het
Aars2 A G 17: 45,514,550 D313G probably damaging Het
Abca9 A T 11: 110,115,447 D1277E probably benign Het
Adgrl1 G T 8: 83,934,901 A981S probably damaging Het
Aff3 T G 1: 38,204,940 K917Q possibly damaging Het
BC049715 A T 6: 136,839,996 H78L probably benign Het
Cacna1g C A 11: 94,411,054 A2027S possibly damaging Het
Camk1g G A 1: 193,356,401 probably benign Het
Carf T C 1: 60,144,002 V386A probably damaging Het
Cd46 A G 1: 195,086,164 S82P probably benign Het
Clic5 A G 17: 44,270,623 E180G possibly damaging Het
Col27a1 A G 4: 63,225,661 T529A probably benign Het
Col7a1 C T 9: 108,980,237 R2627C unknown Het
Cuzd1 G A 7: 131,311,908 probably benign Het
Cwc27 T C 13: 104,807,823 D50G possibly damaging Het
Dhx38 A G 8: 109,555,181 V735A possibly damaging Het
Dhx57 T G 17: 80,258,121 E834A probably damaging Het
Dsg4 A G 18: 20,470,879 D801G probably damaging Het
Dtx1 T C 5: 120,681,399 E578G probably damaging Het
F830016B08Rik A T 18: 60,300,193 H116L probably damaging Het
Fam208b A G 13: 3,596,842 V61A possibly damaging Het
Fbxw18 T C 9: 109,688,839 I360V possibly damaging Het
Fignl2 G A 15: 101,054,093 P103S probably benign Het
Frmpd1 A G 4: 45,284,196 T1006A probably benign Het
Ggnbp2 G T 11: 84,836,374 C545* probably null Het
Gm3336 A G 8: 70,718,645 probably benign Het
Gpr37 T C 6: 25,669,291 N518S probably benign Het
Hbs1l T A 10: 21,342,541 D312E possibly damaging Het
Hoxd10 C A 2: 74,692,720 S247R probably benign Het
Ifnb1 A T 4: 88,522,744 F11I probably benign Het
Marf1 T C 16: 14,151,320 probably benign Het
Myo1f T A 17: 33,601,956 V879E probably benign Het
Naip1 A G 13: 100,409,148 F1291L probably benign Het
Nckap1l A G 15: 103,474,159 E529G probably damaging Het
Npm3 T C 19: 45,748,229 E157G probably damaging Het
Olfr1200 T A 2: 88,767,641 T225S possibly damaging Het
Olfr1240 G T 2: 89,439,396 N294K probably benign Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Ppp6r1 A G 7: 4,633,287 V768A probably benign Het
Prrc1 A G 18: 57,362,492 T14A probably damaging Het
Ranbp2 T C 10: 58,477,283 L1275P probably damaging Het
Rnf214 C A 9: 45,899,823 V181F probably damaging Het
Ror2 T C 13: 53,132,004 N58S probably damaging Het
Selplg G A 5: 113,820,008 T79I probably damaging Het
Setd1b G A 5: 123,157,437 G1023S unknown Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Skint5 A G 4: 113,705,596 V803A unknown Het
Slc25a46 T C 18: 31,583,266 I394M possibly damaging Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Spag17 C A 3: 100,027,590 T704K probably benign Het
Tas2r144 T A 6: 42,216,124 M266K possibly damaging Het
Tbc1d31 T A 15: 57,955,350 L783H probably benign Het
Tbck C A 3: 132,751,232 probably benign Het
Vcan A G 13: 89,691,275 V2050A probably damaging Het
Vmn1r70 T A 7: 10,634,060 N158K probably damaging Het
Vmn2r103 T A 17: 19,792,859 Y81N probably benign Het
Vmn2r103 A G 17: 19,793,464 T173A probably benign Het
Ylpm1 T G 12: 85,014,980 S552A unknown Het
Zdhhc17 A T 10: 110,982,106 Y58* probably null Het
Other mutations in Olfr248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Olfr248 APN 1 174391408 missense probably damaging 1.00
R1720:Olfr248 UTSW 1 174391920 missense probably benign 0.00
R1906:Olfr248 UTSW 1 174391164 missense probably damaging 1.00
R1996:Olfr248 UTSW 1 174391417 missense probably damaging 1.00
R2009:Olfr248 UTSW 1 174391429 missense possibly damaging 0.94
R4745:Olfr248 UTSW 1 174391876 missense probably damaging 1.00
R5294:Olfr248 UTSW 1 174391225 missense probably benign
R5297:Olfr248 UTSW 1 174391200 missense probably benign 0.21
R5665:Olfr248 UTSW 1 174391375 missense probably damaging 1.00
R5784:Olfr248 UTSW 1 174391399 missense probably damaging 1.00
R5857:Olfr248 UTSW 1 174391108 missense possibly damaging 0.59
R6943:Olfr248 UTSW 1 174391841 nonsense probably null
R6975:Olfr248 UTSW 1 174391677 missense probably benign 0.10
R7114:Olfr248 UTSW 1 174391239 missense probably damaging 0.96
R7614:Olfr248 UTSW 1 174391654 missense probably damaging 0.99
R8036:Olfr248 UTSW 1 174391816 missense probably damaging 1.00
R8674:Olfr248 UTSW 1 174391692 missense probably damaging 1.00
R8777:Olfr248 UTSW 1 174391282 missense probably damaging 1.00
R8777-TAIL:Olfr248 UTSW 1 174391282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCTACATACAGGGTTGAGTTTTGCC -3'
(R):5'- AGCCACAGCCTATGTCTGAAATGC -3'

Sequencing Primer
(F):5'- GGTTGAGTTTTGCCAAACTGAATAG -3'
(R):5'- CCTATGTCTGAAATGCGGTTGTC -3'
Posted On2013-04-24