Incidental Mutation 'R0375:Hoxd10'
ID30672
Institutional Source Beutler Lab
Gene Symbol Hoxd10
Ensembl Gene ENSMUSG00000050368
Gene Namehomeobox D10
SynonymsHox-4.5, Hox-5.3
MMRRC Submission 038581-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.584) question?
Stock #R0375 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location74691924-74695105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74692720 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 247 (S247R)
Ref Sequence ENSEMBL: ENSMUSP00000062412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061745]
Predicted Effect probably benign
Transcript: ENSMUST00000061745
AA Change: S247R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000062412
Gene: ENSMUSG00000050368
AA Change: S247R

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
HOX 266 328 3.3e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126966
SMART Domains Protein: ENSMUSP00000133930
Gene: ENSMUSG00000086077

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190845
Meta Mutation Damage Score 0.2557 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Abd-B homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox D genes located on chromosome 2. The encoded nuclear protein functions as a sequence-specific transcription factor that is expressed in the developing limb buds and is involved in differentiation and limb development. Mutations in this gene have been associated with Wilm's tumor and congenital vertical talus (also known as "rocker-bottom foot" deformity or congenital convex pes valgus) and/or a foot deformity resembling that seen in Charcot-Marie-Tooth disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit an abnormal gait associated with defects in sacral vertebrae (including homeotic transformations), hindlimb bones, and muscle innervation. These defects are sometimes seen in heterozygotes as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,046,252 T4707I probably damaging Het
5730522E02Rik T A 11: 25,769,092 Y17F unknown Het
Aars2 A G 17: 45,514,550 D313G probably damaging Het
Abca9 A T 11: 110,115,447 D1277E probably benign Het
Adgrl1 G T 8: 83,934,901 A981S probably damaging Het
Aff3 T G 1: 38,204,940 K917Q possibly damaging Het
BC049715 A T 6: 136,839,996 H78L probably benign Het
Cacna1g C A 11: 94,411,054 A2027S possibly damaging Het
Camk1g G A 1: 193,356,401 probably benign Het
Carf T C 1: 60,144,002 V386A probably damaging Het
Cd46 A G 1: 195,086,164 S82P probably benign Het
Clic5 A G 17: 44,270,623 E180G possibly damaging Het
Col27a1 A G 4: 63,225,661 T529A probably benign Het
Col7a1 C T 9: 108,980,237 R2627C unknown Het
Cuzd1 G A 7: 131,311,908 probably benign Het
Cwc27 T C 13: 104,807,823 D50G possibly damaging Het
Dhx38 A G 8: 109,555,181 V735A possibly damaging Het
Dhx57 T G 17: 80,258,121 E834A probably damaging Het
Dsg4 A G 18: 20,470,879 D801G probably damaging Het
Dtx1 T C 5: 120,681,399 E578G probably damaging Het
F830016B08Rik A T 18: 60,300,193 H116L probably damaging Het
Fam208b A G 13: 3,596,842 V61A possibly damaging Het
Fbxw18 T C 9: 109,688,839 I360V possibly damaging Het
Fignl2 G A 15: 101,054,093 P103S probably benign Het
Frmpd1 A G 4: 45,284,196 T1006A probably benign Het
Ggnbp2 G T 11: 84,836,374 C545* probably null Het
Gm3336 A G 8: 70,718,645 probably benign Het
Gpr37 T C 6: 25,669,291 N518S probably benign Het
Hbs1l T A 10: 21,342,541 D312E possibly damaging Het
Ifnb1 A T 4: 88,522,744 F11I probably benign Het
Marf1 T C 16: 14,151,320 probably benign Het
Myo1f T A 17: 33,601,956 V879E probably benign Het
Naip1 A G 13: 100,409,148 F1291L probably benign Het
Nckap1l A G 15: 103,474,159 E529G probably damaging Het
Npm3 T C 19: 45,748,229 E157G probably damaging Het
Olfr1200 T A 2: 88,767,641 T225S possibly damaging Het
Olfr1240 G T 2: 89,439,396 N294K probably benign Het
Olfr248 A G 1: 174,391,209 T47A probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Ppp6r1 A G 7: 4,633,287 V768A probably benign Het
Prrc1 A G 18: 57,362,492 T14A probably damaging Het
Ranbp2 T C 10: 58,477,283 L1275P probably damaging Het
Rnf214 C A 9: 45,899,823 V181F probably damaging Het
Ror2 T C 13: 53,132,004 N58S probably damaging Het
Selplg G A 5: 113,820,008 T79I probably damaging Het
Setd1b G A 5: 123,157,437 G1023S unknown Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Skint5 A G 4: 113,705,596 V803A unknown Het
Slc25a46 T C 18: 31,583,266 I394M possibly damaging Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Spag17 C A 3: 100,027,590 T704K probably benign Het
Tas2r144 T A 6: 42,216,124 M266K possibly damaging Het
Tbc1d31 T A 15: 57,955,350 L783H probably benign Het
Tbck C A 3: 132,751,232 probably benign Het
Vcan A G 13: 89,691,275 V2050A probably damaging Het
Vmn1r70 T A 7: 10,634,060 N158K probably damaging Het
Vmn2r103 T A 17: 19,792,859 Y81N probably benign Het
Vmn2r103 A G 17: 19,793,464 T173A probably benign Het
Ylpm1 T G 12: 85,014,980 S552A unknown Het
Zdhhc17 A T 10: 110,982,106 Y58* probably null Het
Other mutations in Hoxd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Hoxd10 APN 2 74692442 missense probably benign 0.06
IGL03206:Hoxd10 APN 2 74692432 nonsense probably null
R3004:Hoxd10 UTSW 2 74692362 missense probably benign
R3419:Hoxd10 UTSW 2 74692577 missense probably benign 0.00
R3717:Hoxd10 UTSW 2 74694130 missense probably damaging 0.96
R4627:Hoxd10 UTSW 2 74692292 missense probably benign
R4697:Hoxd10 UTSW 2 74694187 nonsense probably null
R5875:Hoxd10 UTSW 2 74692082 missense possibly damaging 0.95
R6378:Hoxd10 UTSW 2 74694334 missense possibly damaging 0.93
R6597:Hoxd10 UTSW 2 74692640 missense probably benign 0.00
R6711:Hoxd10 UTSW 2 74694163 missense probably damaging 1.00
R6841:Hoxd10 UTSW 2 74692272 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TAGACTGAGTCAGACCTACGCCAC -3'
(R):5'- GCTCAAGACTGATAAACCCGGCAAG -3'

Sequencing Primer
(F):5'- GCAGCTCCACTGTCATGC -3'
(R):5'- GAGAAGCCCCGACCCTTTC -3'
Posted On2013-04-24