Incidental Mutation 'R0375:Pex16'
ID 30675
Institutional Source Beutler Lab
Gene Symbol Pex16
Ensembl Gene ENSMUSG00000027222
Gene Name peroxisomal biogenesis factor 16
Synonyms peroxisome biogenesis factor 16
MMRRC Submission 038581-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.411) question?
Stock # R0375 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 92205021-92211562 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 92210802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 312 (G312D)
Ref Sequence ENSEMBL: ENSMUSP00000028650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028650] [ENSMUST00000050312] [ENSMUST00000054316] [ENSMUST00000111279] [ENSMUST00000111280] [ENSMUST00000191292]
AlphaFold Q91XC9
Predicted Effect probably damaging
Transcript: ENSMUST00000028650
AA Change: G312D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028650
Gene: ENSMUSG00000027222
AA Change: G312D

DomainStartEndE-ValueType
Pfam:Pex16 9 329 1.3e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050312
SMART Domains Protein: ENSMUSP00000050773
Gene: ENSMUSG00000027223

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
low complexity region 71 87 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
SH3 487 544 2.62e-11 SMART
PTB 558 700 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054316
SMART Domains Protein: ENSMUSP00000051464
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
Pfam:DUF4733 4 97 7.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111279
SMART Domains Protein: ENSMUSP00000106910
Gene: ENSMUSG00000027223

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 62 78 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
low complexity region 233 245 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
SH3 478 535 2.62e-11 SMART
PTB 549 691 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111280
SMART Domains Protein: ENSMUSP00000106911
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189714
Predicted Effect probably benign
Transcript: ENSMUST00000191292
Meta Mutation Damage Score 0.6623 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral peroxisomal membrane protein. An inactivating nonsense mutation localized to this gene was observed in a patient with Zellweger syndrome of the complementation group CGD/CG9. Expression of this gene product morphologically and biochemically restores the formation of new peroxisomes, suggesting a role in peroxisome organization and biogenesis. Alternative splicing has been observed for this gene and two variants have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik T A 11: 25,719,092 (GRCm39) Y17F unknown Het
Aars2 A G 17: 45,825,476 (GRCm39) D313G probably damaging Het
Abca9 A T 11: 110,006,273 (GRCm39) D1277E probably benign Het
Adgrl1 G T 8: 84,661,530 (GRCm39) A981S probably damaging Het
Aff3 T G 1: 38,244,021 (GRCm39) K917Q possibly damaging Het
BC049715 A T 6: 136,816,994 (GRCm39) H78L probably benign Het
Bltp1 C T 3: 37,100,401 (GRCm39) T4707I probably damaging Het
Cacna1g C A 11: 94,301,880 (GRCm39) A2027S possibly damaging Het
Camk1g G A 1: 193,038,709 (GRCm39) probably benign Het
Carf T C 1: 60,183,161 (GRCm39) V386A probably damaging Het
Cd46 A G 1: 194,768,472 (GRCm39) S82P probably benign Het
Clic5 A G 17: 44,581,510 (GRCm39) E180G possibly damaging Het
Col27a1 A G 4: 63,143,898 (GRCm39) T529A probably benign Het
Col7a1 C T 9: 108,809,305 (GRCm39) R2627C unknown Het
Cuzd1 G A 7: 130,913,637 (GRCm39) probably benign Het
Cwc27 T C 13: 104,944,331 (GRCm39) D50G possibly damaging Het
Dhx38 A G 8: 110,281,813 (GRCm39) V735A possibly damaging Het
Dhx57 T G 17: 80,565,550 (GRCm39) E834A probably damaging Het
Dsg4 A G 18: 20,603,936 (GRCm39) D801G probably damaging Het
Dtx1 T C 5: 120,819,464 (GRCm39) E578G probably damaging Het
F830016B08Rik A T 18: 60,433,265 (GRCm39) H116L probably damaging Het
Fbxw18 T C 9: 109,517,907 (GRCm39) I360V possibly damaging Het
Fignl2 G A 15: 100,951,974 (GRCm39) P103S probably benign Het
Frmpd1 A G 4: 45,284,196 (GRCm39) T1006A probably benign Het
Ggnbp2 G T 11: 84,727,200 (GRCm39) C545* probably null Het
Gm3336 A G 8: 71,171,294 (GRCm39) probably benign Het
Gpr37 T C 6: 25,669,290 (GRCm39) N518S probably benign Het
Hbs1l T A 10: 21,218,440 (GRCm39) D312E possibly damaging Het
Hoxd10 C A 2: 74,523,064 (GRCm39) S247R probably benign Het
Ifnb1 A T 4: 88,440,981 (GRCm39) F11I probably benign Het
Marf1 T C 16: 13,969,184 (GRCm39) probably benign Het
Myo1f T A 17: 33,820,930 (GRCm39) V879E probably benign Het
Naip1 A G 13: 100,545,656 (GRCm39) F1291L probably benign Het
Nckap1l A G 15: 103,382,586 (GRCm39) E529G probably damaging Het
Npm3 T C 19: 45,736,668 (GRCm39) E157G probably damaging Het
Or10x4 A G 1: 174,218,775 (GRCm39) T47A probably damaging Het
Or4a67 T A 2: 88,597,985 (GRCm39) T225S possibly damaging Het
Or4a68 G T 2: 89,269,740 (GRCm39) N294K probably benign Het
Ppp6r1 A G 7: 4,636,286 (GRCm39) V768A probably benign Het
Prrc1 A G 18: 57,495,564 (GRCm39) T14A probably damaging Het
Ranbp2 T C 10: 58,313,105 (GRCm39) L1275P probably damaging Het
Rnf214 C A 9: 45,811,121 (GRCm39) V181F probably damaging Het
Ror2 T C 13: 53,286,040 (GRCm39) N58S probably damaging Het
Selplg G A 5: 113,958,069 (GRCm39) T79I probably damaging Het
Setd1b G A 5: 123,295,500 (GRCm39) G1023S unknown Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Skint5 A G 4: 113,562,793 (GRCm39) V803A unknown Het
Slc25a46 T C 18: 31,716,319 (GRCm39) I394M possibly damaging Het
Snrnp27 A T 6: 86,657,935 (GRCm39) I101K possibly damaging Het
Spag17 C A 3: 99,934,906 (GRCm39) T704K probably benign Het
Tas2r144 T A 6: 42,193,058 (GRCm39) M266K possibly damaging Het
Tasor2 A G 13: 3,646,842 (GRCm39) V61A possibly damaging Het
Tbc1d31 T A 15: 57,818,746 (GRCm39) L783H probably benign Het
Tbck C A 3: 132,456,993 (GRCm39) probably benign Het
Vcan A G 13: 89,839,394 (GRCm39) V2050A probably damaging Het
Vmn1r70 T A 7: 10,367,987 (GRCm39) N158K probably damaging Het
Vmn2r103 T A 17: 20,013,121 (GRCm39) Y81N probably benign Het
Vmn2r103 A G 17: 20,013,726 (GRCm39) T173A probably benign Het
Ylpm1 T G 12: 85,061,754 (GRCm39) S552A unknown Het
Zdhhc17 A T 10: 110,817,967 (GRCm39) Y58* probably null Het
Other mutations in Pex16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pex16 APN 2 92,209,580 (GRCm39) missense probably benign 0.01
IGL01733:Pex16 APN 2 92,209,173 (GRCm39) missense probably damaging 1.00
IGL02642:Pex16 APN 2 92,206,981 (GRCm39) missense probably damaging 1.00
IGL03350:Pex16 APN 2 92,207,842 (GRCm39) missense probably damaging 0.97
R0143:Pex16 UTSW 2 92,210,802 (GRCm39) missense probably damaging 1.00
R0226:Pex16 UTSW 2 92,206,032 (GRCm39) unclassified probably benign
R0278:Pex16 UTSW 2 92,211,401 (GRCm39) missense probably damaging 1.00
R0437:Pex16 UTSW 2 92,205,937 (GRCm39) missense probably damaging 1.00
R0540:Pex16 UTSW 2 92,205,982 (GRCm39) nonsense probably null
R4809:Pex16 UTSW 2 92,206,983 (GRCm39) missense probably damaging 1.00
R4841:Pex16 UTSW 2 92,209,544 (GRCm39) splice site probably null
R4952:Pex16 UTSW 2 92,209,405 (GRCm39) nonsense probably null
R5382:Pex16 UTSW 2 92,207,875 (GRCm39) missense possibly damaging 0.85
R8144:Pex16 UTSW 2 92,205,985 (GRCm39) missense probably damaging 1.00
R8810:Pex16 UTSW 2 92,209,366 (GRCm39) unclassified probably benign
R9511:Pex16 UTSW 2 92,209,559 (GRCm39) critical splice acceptor site probably null
R9712:Pex16 UTSW 2 92,206,988 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGACTTCCGGTGGTCTAGCCTTTC -3'
(R):5'- TGCCTTACCAGATAAGTCTGCCTCC -3'

Sequencing Primer
(F):5'- CGTTGGGTCCTAGTCCCTTG -3'
(R):5'- AGGCTTGCCAACCTGATATG -3'
Posted On 2013-04-24