Mutagenetix > Incidental Mutation

Incidental Mutation 'R0375:Spag17'

30677

Institutional Source

Beutler Lab

Gene Symbol

Spag17

Ensembl Gene

ENSMUSG00000027867

Gene Name

sperm associated antigen 17

Synonyms

4931427F14Rik, PF6

MMRRC Submission

038581-MU

Accession Numbers

Genbank: NM_028892; MGI: 1921612

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0375 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99885406-100143322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 100027590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 704 (T704K)

Ref Sequence

ENSEMBL: ENSMUSP00000134066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164539]

AlphaFold

Q5S003

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143050

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152586

Predicted Effect

probably benign
Transcript: ENSMUST00000164539
AA Change: T704K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: T704K

Domain	Start	End	E-Value	Type
low complexity region	155	170	N/A	INTRINSIC
low complexity region	384	400	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
coiled coil region	909	964	N/A	INTRINSIC
coiled coil region	1079	1120	N/A	INTRINSIC
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1192	1205	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1223	1238	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1931	1942	N/A	INTRINSIC
Pfam:PapD-like	2171	2277	1.2e-15	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,046,252	T4707I	probably damaging	Het
5730522E02Rik	T	A	11: 25,769,092	Y17F	unknown	Het
Aars2	A	G	17: 45,514,550	D313G	probably damaging	Het
Abca9	A	T	11: 110,115,447	D1277E	probably benign	Het
Adgrl1	G	T	8: 83,934,901	A981S	probably damaging	Het
Aff3	T	G	1: 38,204,940	K917Q	possibly damaging	Het
BC049715	A	T	6: 136,839,996	H78L	probably benign	Het
Cacna1g	C	A	11: 94,411,054	A2027S	possibly damaging	Het
Camk1g	G	A	1: 193,356,401		probably benign	Het
Carf	T	C	1: 60,144,002	V386A	probably damaging	Het
Cd46	A	G	1: 195,086,164	S82P	probably benign	Het
Clic5	A	G	17: 44,270,623	E180G	possibly damaging	Het
Col27a1	A	G	4: 63,225,661	T529A	probably benign	Het
Col7a1	C	T	9: 108,980,237	R2627C	unknown	Het
Cuzd1	G	A	7: 131,311,908		probably benign	Het
Cwc27	T	C	13: 104,807,823	D50G	possibly damaging	Het
Dhx38	A	G	8: 109,555,181	V735A	possibly damaging	Het
Dhx57	T	G	17: 80,258,121	E834A	probably damaging	Het
Dsg4	A	G	18: 20,470,879	D801G	probably damaging	Het
Dtx1	T	C	5: 120,681,399	E578G	probably damaging	Het
F830016B08Rik	A	T	18: 60,300,193	H116L	probably damaging	Het
Fam208b	A	G	13: 3,596,842	V61A	possibly damaging	Het
Fbxw18	T	C	9: 109,688,839	I360V	possibly damaging	Het
Fignl2	G	A	15: 101,054,093	P103S	probably benign	Het
Frmpd1	A	G	4: 45,284,196	T1006A	probably benign	Het
Ggnbp2	G	T	11: 84,836,374	C545*	probably null	Het
Gm3336	A	G	8: 70,718,645		probably benign	Het
Gpr37	T	C	6: 25,669,291	N518S	probably benign	Het
Hbs1l	T	A	10: 21,342,541	D312E	possibly damaging	Het
Hoxd10	C	A	2: 74,692,720	S247R	probably benign	Het
Ifnb1	A	T	4: 88,522,744	F11I	probably benign	Het
Marf1	T	C	16: 14,151,320		probably benign	Het
Myo1f	T	A	17: 33,601,956	V879E	probably benign	Het
Naip1	A	G	13: 100,409,148	F1291L	probably benign	Het
Nckap1l	A	G	15: 103,474,159	E529G	probably damaging	Het
Npm3	T	C	19: 45,748,229	E157G	probably damaging	Het
Olfr1200	T	A	2: 88,767,641	T225S	possibly damaging	Het
Olfr1240	G	T	2: 89,439,396	N294K	probably benign	Het
Olfr248	A	G	1: 174,391,209	T47A	probably damaging	Het
Pex16	G	A	2: 92,380,457	G312D	probably damaging	Het
Ppp6r1	A	G	7: 4,633,287	V768A	probably benign	Het
Prrc1	A	G	18: 57,362,492	T14A	probably damaging	Het
Ranbp2	T	C	10: 58,477,283	L1275P	probably damaging	Het
Rnf214	C	A	9: 45,899,823	V181F	probably damaging	Het
Ror2	T	C	13: 53,132,004	N58S	probably damaging	Het
Selplg	G	A	5: 113,820,008	T79I	probably damaging	Het
Setd1b	G	A	5: 123,157,437	G1023S	unknown	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Skint5	A	G	4: 113,705,596	V803A	unknown	Het
Slc25a46	T	C	18: 31,583,266	I394M	possibly damaging	Het
Snrnp27	A	T	6: 86,680,953	I101K	possibly damaging	Het
Tas2r144	T	A	6: 42,216,124	M266K	possibly damaging	Het
Tbc1d31	T	A	15: 57,955,350	L783H	probably benign	Het
Tbck	C	A	3: 132,751,232		probably benign	Het
Vcan	A	G	13: 89,691,275	V2050A	probably damaging	Het
Vmn1r70	T	A	7: 10,634,060	N158K	probably damaging	Het
Vmn2r103	A	G	17: 19,793,464	T173A	probably benign	Het
Vmn2r103	T	A	17: 19,792,859	Y81N	probably benign	Het
Ylpm1	T	G	12: 85,014,980	S552A	unknown	Het
Zdhhc17	A	T	10: 110,982,106	Y58*	probably null	Het

Other mutations in Spag17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Spag17	APN	3	100063375	missense	probably benign	0.00
IGL01143:Spag17	APN	3	99939298	missense	probably benign	0.00
IGL01329:Spag17	APN	3	100095549	missense	probably benign	0.16
IGL01393:Spag17	APN	3	100027610	missense	possibly damaging	0.53
IGL01617:Spag17	APN	3	100109508	missense	possibly damaging	0.65
IGL01705:Spag17	APN	3	100022730	missense	probably benign	0.01
IGL01928:Spag17	APN	3	99940074	splice site	probably benign
IGL01981:Spag17	APN	3	100058833	missense	probably benign	0.03
IGL02435:Spag17	APN	3	99982444	missense	possibly damaging	0.53
IGL02452:Spag17	APN	3	100027391	missense	probably benign	0.00
IGL02465:Spag17	APN	3	100075871	missense	probably damaging	0.96
IGL02615:Spag17	APN	3	100072085	missense	probably benign	0.09
IGL02751:Spag17	APN	3	100010794	nonsense	probably null
IGL02803:Spag17	APN	3	100109397	missense	probably benign
IGL02898:Spag17	APN	3	100101386	missense	probably benign	0.00
IGL03037:Spag17	APN	3	100072170	splice site	probably null
IGL03068:Spag17	APN	3	100080205	missense	probably benign	0.35
IGL03131:Spag17	APN	3	100010759	missense	possibly damaging	0.85
IGL03224:Spag17	APN	3	100010840	missense	possibly damaging	0.53
FR4342:Spag17	UTSW	3	100056249	small insertion	probably benign
FR4342:Spag17	UTSW	3	100056252	small insertion	probably benign
FR4548:Spag17	UTSW	3	100056254	small insertion	probably benign
FR4589:Spag17	UTSW	3	100056245	small insertion	probably benign
FR4589:Spag17	UTSW	3	100056258	small insertion	probably benign
FR4737:Spag17	UTSW	3	100056257	small insertion	probably benign
FR4976:Spag17	UTSW	3	100056254	small insertion	probably benign
FR4976:Spag17	UTSW	3	100056255	small insertion	probably benign
N/A:Spag17	UTSW	3	99982254	splice site	probably benign
PIT4504001:Spag17	UTSW	3	100103110	critical splice acceptor site	probably null
PIT4514001:Spag17	UTSW	3	100013211	missense	possibly damaging	0.53
R0107:Spag17	UTSW	3	100050787	missense	possibly damaging	0.72
R0230:Spag17	UTSW	3	100106827	missense	probably benign	0.08
R0243:Spag17	UTSW	3	100085368	missense	probably benign	0.04
R0321:Spag17	UTSW	3	100101403	missense	probably damaging	0.99
R0417:Spag17	UTSW	3	100065554	missense	probably benign	0.11
R0490:Spag17	UTSW	3	99982411	missense	probably damaging	0.97
R0537:Spag17	UTSW	3	100125302	missense	probably damaging	0.98
R0714:Spag17	UTSW	3	100080156	missense	probably damaging	0.97
R0844:Spag17	UTSW	3	100004785	missense	probably benign
R0919:Spag17	UTSW	3	100071943	splice site	probably benign
R0926:Spag17	UTSW	3	100072116	missense	probably benign
R1037:Spag17	UTSW	3	100103117	missense	probably benign	0.01
R1075:Spag17	UTSW	3	100093676	missense	probably damaging	0.99
R1109:Spag17	UTSW	3	100027351	missense	possibly damaging	0.86
R1213:Spag17	UTSW	3	100095638	missense	probably benign	0.01
R1221:Spag17	UTSW	3	99982268	missense	possibly damaging	0.72
R1576:Spag17	UTSW	3	99939363	missense	possibly damaging	0.73
R1586:Spag17	UTSW	3	100021752	missense	possibly damaging	0.53
R1768:Spag17	UTSW	3	100027352	missense	possibly damaging	0.53
R1782:Spag17	UTSW	3	100010754	missense	probably benign	0.02
R1789:Spag17	UTSW	3	99939356	missense	possibly damaging	0.73
R1945:Spag17	UTSW	3	99939982	missense	probably benign
R2065:Spag17	UTSW	3	100013208	missense	probably benign	0.03
R2118:Spag17	UTSW	3	100049240	missense	possibly damaging	0.72
R2265:Spag17	UTSW	3	100061866	splice site	probably null
R2266:Spag17	UTSW	3	100061866	splice site	probably null
R2267:Spag17	UTSW	3	100061866	splice site	probably null
R2268:Spag17	UTSW	3	100061866	splice site	probably null
R2271:Spag17	UTSW	3	100106797	missense	probably damaging	1.00
R2389:Spag17	UTSW	3	100106837	missense	probably benign	0.27
R2420:Spag17	UTSW	3	100027619	missense	probably benign
R2422:Spag17	UTSW	3	100027619	missense	probably benign
R2423:Spag17	UTSW	3	100103456	missense	probably benign
R3407:Spag17	UTSW	3	100085299	missense	probably benign	0.09
R3801:Spag17	UTSW	3	100053853	missense	possibly damaging	0.53
R3856:Spag17	UTSW	3	100106759	missense	probably damaging	1.00
R4021:Spag17	UTSW	3	100049230	missense	probably benign	0.00
R4022:Spag17	UTSW	3	100049230	missense	probably benign	0.00
R4408:Spag17	UTSW	3	100103378	missense	probably benign
R4468:Spag17	UTSW	3	100085366	missense	probably damaging	0.98
R4540:Spag17	UTSW	3	100088381	missense	probably damaging	1.00
R4621:Spag17	UTSW	3	100103243	missense	probably benign	0.08
R4622:Spag17	UTSW	3	100103243	missense	probably benign	0.08
R4756:Spag17	UTSW	3	100103385	missense	possibly damaging	0.68
R4797:Spag17	UTSW	3	99984479	missense	possibly damaging	0.70
R4855:Spag17	UTSW	3	100063333	missense	probably benign	0.02
R4887:Spag17	UTSW	3	100050831	missense	probably damaging	1.00
R4962:Spag17	UTSW	3	100027623	missense	probably benign
R5030:Spag17	UTSW	3	100085341	nonsense	probably null
R5042:Spag17	UTSW	3	100072149	missense	probably damaging	1.00
R5074:Spag17	UTSW	3	100080118	missense	possibly damaging	0.94
R5195:Spag17	UTSW	3	100101388	missense	probably benign	0.16
R5200:Spag17	UTSW	3	100063471	nonsense	probably null
R5267:Spag17	UTSW	3	100061948	missense	probably damaging	0.98
R5360:Spag17	UTSW	3	100109410	missense	probably benign	0.00
R5444:Spag17	UTSW	3	100056152	missense	probably benign	0.06
R5498:Spag17	UTSW	3	100103345	missense	possibly damaging	0.83
R5503:Spag17	UTSW	3	100027244	missense	possibly damaging	0.72
R5540:Spag17	UTSW	3	100056272	missense	possibly damaging	0.91
R5547:Spag17	UTSW	3	100056152	missense	probably benign	0.06
R5575:Spag17	UTSW	3	100053822	missense	possibly damaging	0.85
R5629:Spag17	UTSW	3	100080119	missense	probably benign	0.33
R5639:Spag17	UTSW	3	100056166	missense	probably damaging	1.00
R5842:Spag17	UTSW	3	99939250	missense	possibly damaging	0.85
R5976:Spag17	UTSW	3	100095791	nonsense	probably null
R6082:Spag17	UTSW	3	100124185	missense	possibly damaging	0.46
R6228:Spag17	UTSW	3	100022602	missense	probably benign	0.33
R6254:Spag17	UTSW	3	100065585	missense	probably benign	0.03
R6321:Spag17	UTSW	3	100088427	missense	probably benign	0.05
R6446:Spag17	UTSW	3	100103132	missense	probably benign
R6687:Spag17	UTSW	3	100092950	missense	probably benign	0.07
R6853:Spag17	UTSW	3	100013235	missense	possibly damaging	0.86
R6946:Spag17	UTSW	3	100004683	missense	possibly damaging	0.53
R6953:Spag17	UTSW	3	100034975	missense	possibly damaging	0.53
R7038:Spag17	UTSW	3	99984609	missense	probably benign	0.00
R7084:Spag17	UTSW	3	99939270	missense	probably benign	0.18
R7126:Spag17	UTSW	3	100101435	missense	probably benign	0.00
R7144:Spag17	UTSW	3	100027401	splice site	probably null
R7198:Spag17	UTSW	3	100095572	missense	probably benign	0.02
R7318:Spag17	UTSW	3	99939983	missense	probably benign	0.00
R7403:Spag17	UTSW	3	99939375	missense	possibly damaging	0.53
R7409:Spag17	UTSW	3	100027231	missense	possibly damaging	0.73
R7409:Spag17	UTSW	3	100034159	missense	probably benign	0.00
R7537:Spag17	UTSW	3	99939247	missense	possibly damaging	0.96
R7609:Spag17	UTSW	3	100095595	nonsense	probably null
R7772:Spag17	UTSW	3	100080118	missense	probably damaging	0.98
R7842:Spag17	UTSW	3	100053858	missense	probably benign	0.18
R7963:Spag17	UTSW	3	100022638	missense	probably benign	0.02
R8168:Spag17	UTSW	3	100034984	missense	possibly damaging	0.96
R8291:Spag17	UTSW	3	100060850	missense	probably benign
R8347:Spag17	UTSW	3	100027641	missense	probably benign
R8383:Spag17	UTSW	3	100085392	missense	probably damaging	0.98
R8474:Spag17	UTSW	3	100027270	missense	probably benign	0.00
R8528:Spag17	UTSW	3	100124185	missense	possibly damaging	0.46
R8804:Spag17	UTSW	3	99967190	missense	probably benign
R8809:Spag17	UTSW	3	99982422	missense	probably benign	0.33
R8818:Spag17	UTSW	3	100013227	missense	probably benign	0.02
R8830:Spag17	UTSW	3	100125435	missense	possibly damaging	0.77
R8890:Spag17	UTSW	3	100004678	missense	possibly damaging	0.73
R9008:Spag17	UTSW	3	100027626	missense	possibly damaging	0.73
R9095:Spag17	UTSW	3	100004776	missense	possibly damaging	0.86
R9143:Spag17	UTSW	3	100027590	missense	probably benign
R9182:Spag17	UTSW	3	100058842	missense	possibly damaging	0.92
R9211:Spag17	UTSW	3	100125298	critical splice acceptor site	probably benign
R9344:Spag17	UTSW	3	100103477	missense	probably benign	0.01
R9354:Spag17	UTSW	3	100027589	missense	probably benign
R9527:Spag17	UTSW	3	100063461	missense	probably damaging	1.00
R9658:Spag17	UTSW	3	100027616	missense	possibly damaging	0.93
R9738:Spag17	UTSW	3	100027210	missense	possibly damaging	0.53
X0025:Spag17	UTSW	3	100101451	missense	probably benign	0.31
Z1088:Spag17	UTSW	3	100095630	missense	probably benign	0.09
Z1176:Spag17	UTSW	3	100012993	missense	probably benign	0.18
Z1177:Spag17	UTSW	3	100088399	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGTGATGACATGAACCCTTGGTG -3'
(R):5'- TGTTTCTGTCTCAGCATAGCAGAGC -3'

Sequencing Primer
(F):5'- AATCCTGCCAGGTTCGCTAAG -3'
(R):5'- TAGCAGAGCCTATGCACACTTTC -3'

Posted On

2013-04-24