Incidental Mutation 'R0375:Ifnb1'
ID30681
Institutional Source Beutler Lab
Gene Symbol Ifnb1
Ensembl Gene ENSMUSG00000048806
Gene Nameinterferon beta 1, fibroblast
SynonymsIFNB, interferon beta 1, fibroblast, Ifb, IFN-beta
MMRRC Submission 038581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0375 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88522025-88522774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88522744 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 11 (F11I)
Ref Sequence ENSEMBL: ENSMUSP00000056720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055671]
PDB Structure THREE-DIMENSIONAL CRYSTAL STRUCTURE OF RECOMBINANT MURINE INTERFERON-BETA [X-RAY DIFFRACTION]
Crystal structure of recombinant murine interferon beta [X-RAY DIFFRACTION]
Murine Ifnar1 in complex with interferon-beta [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000055671
AA Change: F11I

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056720
Gene: ENSMUSG00000048806
AA Change: F11I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IFabd 56 170 3.87e-49 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine that belongs to the interferon family of signaling proteins, which are released as part of the innate immune response to pathogens. The protein encoded by this gene belongs to the type I class of interferons, which are important for defense against viral infections. In addition, type I interferons are involved in cell differentiation and anti-tumor defenses. Following secretion in response to a pathogen, type I interferons bind a homologous receptor complex and induce transcription of genes such as those encoding inflammatory cytokines and chemokines. Overactivation of type I interferon secretion is linked to autoimmune diseases. Mice deficient for this gene display several phenotypes including defects in B cell maturation and increased susceptibility to viral infection. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit enhanced proliferation and reduced TNF-alpha production by activated T lymphocytes, a defect in B cell maturation, fewer circulating granulocytes and macrophages, and increased viral susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,046,252 T4707I probably damaging Het
5730522E02Rik T A 11: 25,769,092 Y17F unknown Het
Aars2 A G 17: 45,514,550 D313G probably damaging Het
Abca9 A T 11: 110,115,447 D1277E probably benign Het
Adgrl1 G T 8: 83,934,901 A981S probably damaging Het
Aff3 T G 1: 38,204,940 K917Q possibly damaging Het
BC049715 A T 6: 136,839,996 H78L probably benign Het
Cacna1g C A 11: 94,411,054 A2027S possibly damaging Het
Camk1g G A 1: 193,356,401 probably benign Het
Carf T C 1: 60,144,002 V386A probably damaging Het
Cd46 A G 1: 195,086,164 S82P probably benign Het
Clic5 A G 17: 44,270,623 E180G possibly damaging Het
Col27a1 A G 4: 63,225,661 T529A probably benign Het
Col7a1 C T 9: 108,980,237 R2627C unknown Het
Cuzd1 G A 7: 131,311,908 probably benign Het
Cwc27 T C 13: 104,807,823 D50G possibly damaging Het
Dhx38 A G 8: 109,555,181 V735A possibly damaging Het
Dhx57 T G 17: 80,258,121 E834A probably damaging Het
Dsg4 A G 18: 20,470,879 D801G probably damaging Het
Dtx1 T C 5: 120,681,399 E578G probably damaging Het
F830016B08Rik A T 18: 60,300,193 H116L probably damaging Het
Fam208b A G 13: 3,596,842 V61A possibly damaging Het
Fbxw18 T C 9: 109,688,839 I360V possibly damaging Het
Fignl2 G A 15: 101,054,093 P103S probably benign Het
Frmpd1 A G 4: 45,284,196 T1006A probably benign Het
Ggnbp2 G T 11: 84,836,374 C545* probably null Het
Gm3336 A G 8: 70,718,645 probably benign Het
Gpr37 T C 6: 25,669,291 N518S probably benign Het
Hbs1l T A 10: 21,342,541 D312E possibly damaging Het
Hoxd10 C A 2: 74,692,720 S247R probably benign Het
Marf1 T C 16: 14,151,320 probably benign Het
Myo1f T A 17: 33,601,956 V879E probably benign Het
Naip1 A G 13: 100,409,148 F1291L probably benign Het
Nckap1l A G 15: 103,474,159 E529G probably damaging Het
Npm3 T C 19: 45,748,229 E157G probably damaging Het
Olfr1200 T A 2: 88,767,641 T225S possibly damaging Het
Olfr1240 G T 2: 89,439,396 N294K probably benign Het
Olfr248 A G 1: 174,391,209 T47A probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Ppp6r1 A G 7: 4,633,287 V768A probably benign Het
Prrc1 A G 18: 57,362,492 T14A probably damaging Het
Ranbp2 T C 10: 58,477,283 L1275P probably damaging Het
Rnf214 C A 9: 45,899,823 V181F probably damaging Het
Ror2 T C 13: 53,132,004 N58S probably damaging Het
Selplg G A 5: 113,820,008 T79I probably damaging Het
Setd1b G A 5: 123,157,437 G1023S unknown Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Skint5 A G 4: 113,705,596 V803A unknown Het
Slc25a46 T C 18: 31,583,266 I394M possibly damaging Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Spag17 C A 3: 100,027,590 T704K probably benign Het
Tas2r144 T A 6: 42,216,124 M266K possibly damaging Het
Tbc1d31 T A 15: 57,955,350 L783H probably benign Het
Tbck C A 3: 132,751,232 probably benign Het
Vcan A G 13: 89,691,275 V2050A probably damaging Het
Vmn1r70 T A 7: 10,634,060 N158K probably damaging Het
Vmn2r103 T A 17: 19,792,859 Y81N probably benign Het
Vmn2r103 A G 17: 19,793,464 T173A probably benign Het
Ylpm1 T G 12: 85,014,980 S552A unknown Het
Zdhhc17 A T 10: 110,982,106 Y58* probably null Het
Other mutations in Ifnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ifnb1 APN 4 88522243 missense probably benign 0.01
IGL02434:Ifnb1 APN 4 88522518 missense probably damaging 1.00
IGL02725:Ifnb1 APN 4 88522630 missense probably benign 0.02
R0395:Ifnb1 UTSW 4 88522529 missense possibly damaging 0.95
R2063:Ifnb1 UTSW 4 88522759 missense possibly damaging 0.88
R2064:Ifnb1 UTSW 4 88522759 missense possibly damaging 0.88
R2065:Ifnb1 UTSW 4 88522759 missense possibly damaging 0.88
R2066:Ifnb1 UTSW 4 88522759 missense possibly damaging 0.88
R6091:Ifnb1 UTSW 4 88522576 missense probably benign 0.00
R7499:Ifnb1 UTSW 4 88522674 missense probably benign 0.00
R8902:Ifnb1 UTSW 4 88522310 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTGAGGACATCTCCCACGTCAATC -3'
(R):5'- TCCTCTGAGGCAGAAAGGACCATC -3'

Sequencing Primer
(F):5'- GCAAAGGCAGTGTAACTCTTCTG -3'
(R):5'- GGACCATCCCTTATAAATAGCACAGG -3'
Posted On2013-04-24