Mutagenetix > Incidental Mutation

Incidental Mutation 'R0375:Ifnb1'

30681

Institutional Source

Beutler Lab

Gene Symbol

Ifnb1

Ensembl Gene

ENSMUSG00000048806

Gene Name

interferon beta 1, fibroblast

Synonyms

IFNB, interferon beta 1, fibroblast, Ifb, IFN-beta

MMRRC Submission

038581-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R0375 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88522025-88522774 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 88522744 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 11 (F11I)

Ref Sequence

ENSEMBL: ENSMUSP00000056720 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055671]

AlphaFold

P01575

PDB Structure

THREE-DIMENSIONAL CRYSTAL STRUCTURE OF RECOMBINANT MURINE INTERFERON-BETA [X-RAY DIFFRACTION]
Crystal structure of recombinant murine interferon beta [X-RAY DIFFRACTION]
Murine Ifnar1 in complex with interferon-beta [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000055671
AA Change: F11I

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000056720
Gene: ENSMUSG00000048806
AA Change: F11I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IFabd	56	170	3.87e-49	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine that belongs to the interferon family of signaling proteins, which are released as part of the innate immune response to pathogens. The protein encoded by this gene belongs to the type I class of interferons, which are important for defense against viral infections. In addition, type I interferons are involved in cell differentiation and anti-tumor defenses. Following secretion in response to a pathogen, type I interferons bind a homologous receptor complex and induce transcription of genes such as those encoding inflammatory cytokines and chemokines. Overactivation of type I interferon secretion is linked to autoimmune diseases. Mice deficient for this gene display several phenotypes including defects in B cell maturation and increased susceptibility to viral infection. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit enhanced proliferation and reduced TNF-alpha production by activated T lymphocytes, a defect in B cell maturation, fewer circulating granulocytes and macrophages, and increased viral susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,046,252	T4707I	probably damaging	Het
5730522E02Rik	T	A	11: 25,769,092	Y17F	unknown	Het
Aars2	A	G	17: 45,514,550	D313G	probably damaging	Het
Abca9	A	T	11: 110,115,447	D1277E	probably benign	Het
Adgrl1	G	T	8: 83,934,901	A981S	probably damaging	Het
Aff3	T	G	1: 38,204,940	K917Q	possibly damaging	Het
BC049715	A	T	6: 136,839,996	H78L	probably benign	Het
Cacna1g	C	A	11: 94,411,054	A2027S	possibly damaging	Het
Camk1g	G	A	1: 193,356,401		probably benign	Het
Carf	T	C	1: 60,144,002	V386A	probably damaging	Het
Cd46	A	G	1: 195,086,164	S82P	probably benign	Het
Clic5	A	G	17: 44,270,623	E180G	possibly damaging	Het
Col27a1	A	G	4: 63,225,661	T529A	probably benign	Het
Col7a1	C	T	9: 108,980,237	R2627C	unknown	Het
Cuzd1	G	A	7: 131,311,908		probably benign	Het
Cwc27	T	C	13: 104,807,823	D50G	possibly damaging	Het
Dhx38	A	G	8: 109,555,181	V735A	possibly damaging	Het
Dhx57	T	G	17: 80,258,121	E834A	probably damaging	Het
Dsg4	A	G	18: 20,470,879	D801G	probably damaging	Het
Dtx1	T	C	5: 120,681,399	E578G	probably damaging	Het
F830016B08Rik	A	T	18: 60,300,193	H116L	probably damaging	Het
Fam208b	A	G	13: 3,596,842	V61A	possibly damaging	Het
Fbxw18	T	C	9: 109,688,839	I360V	possibly damaging	Het
Fignl2	G	A	15: 101,054,093	P103S	probably benign	Het
Frmpd1	A	G	4: 45,284,196	T1006A	probably benign	Het
Ggnbp2	G	T	11: 84,836,374	C545*	probably null	Het
Gm3336	A	G	8: 70,718,645		probably benign	Het
Gpr37	T	C	6: 25,669,291	N518S	probably benign	Het
Hbs1l	T	A	10: 21,342,541	D312E	possibly damaging	Het
Hoxd10	C	A	2: 74,692,720	S247R	probably benign	Het
Marf1	T	C	16: 14,151,320		probably benign	Het
Myo1f	T	A	17: 33,601,956	V879E	probably benign	Het
Naip1	A	G	13: 100,409,148	F1291L	probably benign	Het
Nckap1l	A	G	15: 103,474,159	E529G	probably damaging	Het
Npm3	T	C	19: 45,748,229	E157G	probably damaging	Het
Olfr1200	T	A	2: 88,767,641	T225S	possibly damaging	Het
Olfr1240	G	T	2: 89,439,396	N294K	probably benign	Het
Olfr248	A	G	1: 174,391,209	T47A	probably damaging	Het
Pex16	G	A	2: 92,380,457	G312D	probably damaging	Het
Ppp6r1	A	G	7: 4,633,287	V768A	probably benign	Het
Prrc1	A	G	18: 57,362,492	T14A	probably damaging	Het
Ranbp2	T	C	10: 58,477,283	L1275P	probably damaging	Het
Rnf214	C	A	9: 45,899,823	V181F	probably damaging	Het
Ror2	T	C	13: 53,132,004	N58S	probably damaging	Het
Selplg	G	A	5: 113,820,008	T79I	probably damaging	Het
Setd1b	G	A	5: 123,157,437	G1023S	unknown	Het
Sf3b2	C	T	19: 5,274,824	D845N	probably damaging	Het
Skint5	A	G	4: 113,705,596	V803A	unknown	Het
Slc25a46	T	C	18: 31,583,266	I394M	possibly damaging	Het
Snrnp27	A	T	6: 86,680,953	I101K	possibly damaging	Het
Spag17	C	A	3: 100,027,590	T704K	probably benign	Het
Tas2r144	T	A	6: 42,216,124	M266K	possibly damaging	Het
Tbc1d31	T	A	15: 57,955,350	L783H	probably benign	Het
Tbck	C	A	3: 132,751,232		probably benign	Het
Vcan	A	G	13: 89,691,275	V2050A	probably damaging	Het
Vmn1r70	T	A	7: 10,634,060	N158K	probably damaging	Het
Vmn2r103	T	A	17: 19,792,859	Y81N	probably benign	Het
Vmn2r103	A	G	17: 19,793,464	T173A	probably benign	Het
Ylpm1	T	G	12: 85,014,980	S552A	unknown	Het
Zdhhc17	A	T	10: 110,982,106	Y58*	probably null	Het

Other mutations in Ifnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ifnb1	APN	4	88522243	missense	probably benign	0.01
IGL02434:Ifnb1	APN	4	88522518	missense	probably damaging	1.00
IGL02725:Ifnb1	APN	4	88522630	missense	probably benign	0.02
R0395:Ifnb1	UTSW	4	88522529	missense	possibly damaging	0.95
R2063:Ifnb1	UTSW	4	88522759	missense	possibly damaging	0.88
R2064:Ifnb1	UTSW	4	88522759	missense	possibly damaging	0.88
R2065:Ifnb1	UTSW	4	88522759	missense	possibly damaging	0.88
R2066:Ifnb1	UTSW	4	88522759	missense	possibly damaging	0.88
R6091:Ifnb1	UTSW	4	88522576	missense	probably benign	0.00
R7499:Ifnb1	UTSW	4	88522674	missense	probably benign	0.00
R8902:Ifnb1	UTSW	4	88522310	missense	probably damaging	0.99
R9484:Ifnb1	UTSW	4	88522678	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTTGAGGACATCTCCCACGTCAATC -3'
(R):5'- TCCTCTGAGGCAGAAAGGACCATC -3'

Sequencing Primer
(F):5'- GCAAAGGCAGTGTAACTCTTCTG -3'
(R):5'- GGACCATCCCTTATAAATAGCACAGG -3'

Posted On

2013-04-24