Incidental Mutation 'R0375:Gpr37'
ID 30685
Institutional Source Beutler Lab
Gene Symbol Gpr37
Ensembl Gene ENSMUSG00000039904
Gene Name G protein-coupled receptor 37
Synonyms parkin-associated endothelin B-like receptor, Pael-R
MMRRC Submission 038581-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R0375 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 25668522-25689979 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25669290 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 518 (N518S)
Ref Sequence ENSEMBL: ENSMUSP00000052185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054867] [ENSMUST00000200812]
AlphaFold Q9QY42
Predicted Effect probably benign
Transcript: ENSMUST00000054867
AA Change: N518S

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000052185
Gene: ENSMUSG00000039904
AA Change: N518S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 536 5.2e-33 PFAM
low complexity region 549 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200812
SMART Domains Protein: ENSMUSP00000144683
Gene: ENSMUSG00000039904

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 421 3.4e-26 PFAM
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced striatal dopamine content, enhanced amphetamine sensitivity, reduced motor activity and coordination and increased percentage of body fat in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik T A 11: 25,719,092 (GRCm39) Y17F unknown Het
Aars2 A G 17: 45,825,476 (GRCm39) D313G probably damaging Het
Abca9 A T 11: 110,006,273 (GRCm39) D1277E probably benign Het
Adgrl1 G T 8: 84,661,530 (GRCm39) A981S probably damaging Het
Aff3 T G 1: 38,244,021 (GRCm39) K917Q possibly damaging Het
BC049715 A T 6: 136,816,994 (GRCm39) H78L probably benign Het
Bltp1 C T 3: 37,100,401 (GRCm39) T4707I probably damaging Het
Cacna1g C A 11: 94,301,880 (GRCm39) A2027S possibly damaging Het
Camk1g G A 1: 193,038,709 (GRCm39) probably benign Het
Carf T C 1: 60,183,161 (GRCm39) V386A probably damaging Het
Cd46 A G 1: 194,768,472 (GRCm39) S82P probably benign Het
Clic5 A G 17: 44,581,510 (GRCm39) E180G possibly damaging Het
Col27a1 A G 4: 63,143,898 (GRCm39) T529A probably benign Het
Col7a1 C T 9: 108,809,305 (GRCm39) R2627C unknown Het
Cuzd1 G A 7: 130,913,637 (GRCm39) probably benign Het
Cwc27 T C 13: 104,944,331 (GRCm39) D50G possibly damaging Het
Dhx38 A G 8: 110,281,813 (GRCm39) V735A possibly damaging Het
Dhx57 T G 17: 80,565,550 (GRCm39) E834A probably damaging Het
Dsg4 A G 18: 20,603,936 (GRCm39) D801G probably damaging Het
Dtx1 T C 5: 120,819,464 (GRCm39) E578G probably damaging Het
F830016B08Rik A T 18: 60,433,265 (GRCm39) H116L probably damaging Het
Fbxw18 T C 9: 109,517,907 (GRCm39) I360V possibly damaging Het
Fignl2 G A 15: 100,951,974 (GRCm39) P103S probably benign Het
Frmpd1 A G 4: 45,284,196 (GRCm39) T1006A probably benign Het
Ggnbp2 G T 11: 84,727,200 (GRCm39) C545* probably null Het
Gm3336 A G 8: 71,171,294 (GRCm39) probably benign Het
Hbs1l T A 10: 21,218,440 (GRCm39) D312E possibly damaging Het
Hoxd10 C A 2: 74,523,064 (GRCm39) S247R probably benign Het
Ifnb1 A T 4: 88,440,981 (GRCm39) F11I probably benign Het
Marf1 T C 16: 13,969,184 (GRCm39) probably benign Het
Myo1f T A 17: 33,820,930 (GRCm39) V879E probably benign Het
Naip1 A G 13: 100,545,656 (GRCm39) F1291L probably benign Het
Nckap1l A G 15: 103,382,586 (GRCm39) E529G probably damaging Het
Npm3 T C 19: 45,736,668 (GRCm39) E157G probably damaging Het
Or10x4 A G 1: 174,218,775 (GRCm39) T47A probably damaging Het
Or4a67 T A 2: 88,597,985 (GRCm39) T225S possibly damaging Het
Or4a68 G T 2: 89,269,740 (GRCm39) N294K probably benign Het
Pex16 G A 2: 92,210,802 (GRCm39) G312D probably damaging Het
Ppp6r1 A G 7: 4,636,286 (GRCm39) V768A probably benign Het
Prrc1 A G 18: 57,495,564 (GRCm39) T14A probably damaging Het
Ranbp2 T C 10: 58,313,105 (GRCm39) L1275P probably damaging Het
Rnf214 C A 9: 45,811,121 (GRCm39) V181F probably damaging Het
Ror2 T C 13: 53,286,040 (GRCm39) N58S probably damaging Het
Selplg G A 5: 113,958,069 (GRCm39) T79I probably damaging Het
Setd1b G A 5: 123,295,500 (GRCm39) G1023S unknown Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Skint5 A G 4: 113,562,793 (GRCm39) V803A unknown Het
Slc25a46 T C 18: 31,716,319 (GRCm39) I394M possibly damaging Het
Snrnp27 A T 6: 86,657,935 (GRCm39) I101K possibly damaging Het
Spag17 C A 3: 99,934,906 (GRCm39) T704K probably benign Het
Tas2r144 T A 6: 42,193,058 (GRCm39) M266K possibly damaging Het
Tasor2 A G 13: 3,646,842 (GRCm39) V61A possibly damaging Het
Tbc1d31 T A 15: 57,818,746 (GRCm39) L783H probably benign Het
Tbck C A 3: 132,456,993 (GRCm39) probably benign Het
Vcan A G 13: 89,839,394 (GRCm39) V2050A probably damaging Het
Vmn1r70 T A 7: 10,367,987 (GRCm39) N158K probably damaging Het
Vmn2r103 T A 17: 20,013,121 (GRCm39) Y81N probably benign Het
Vmn2r103 A G 17: 20,013,726 (GRCm39) T173A probably benign Het
Ylpm1 T G 12: 85,061,754 (GRCm39) S552A unknown Het
Zdhhc17 A T 10: 110,817,967 (GRCm39) Y58* probably null Het
Other mutations in Gpr37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Gpr37 APN 6 25,669,317 (GRCm39) missense possibly damaging 0.65
IGL01595:Gpr37 APN 6 25,669,572 (GRCm39) missense probably damaging 1.00
IGL01670:Gpr37 APN 6 25,669,833 (GRCm39) missense probably damaging 1.00
IGL02552:Gpr37 APN 6 25,688,686 (GRCm39) missense probably benign 0.05
IGL03331:Gpr37 APN 6 25,669,728 (GRCm39) missense probably benign 0.26
R0534:Gpr37 UTSW 6 25,669,823 (GRCm39) nonsense probably null
R0892:Gpr37 UTSW 6 25,688,206 (GRCm39) missense probably damaging 1.00
R1481:Gpr37 UTSW 6 25,669,137 (GRCm39) missense probably damaging 0.99
R1700:Gpr37 UTSW 6 25,669,623 (GRCm39) missense probably benign 0.09
R2083:Gpr37 UTSW 6 25,688,416 (GRCm39) missense possibly damaging 0.62
R2089:Gpr37 UTSW 6 25,689,062 (GRCm39) missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25,689,062 (GRCm39) missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25,689,062 (GRCm39) missense possibly damaging 0.73
R2112:Gpr37 UTSW 6 25,669,380 (GRCm39) missense possibly damaging 0.91
R2847:Gpr37 UTSW 6 25,666,945 (GRCm39) unclassified probably benign
R2848:Gpr37 UTSW 6 25,666,945 (GRCm39) unclassified probably benign
R4119:Gpr37 UTSW 6 25,688,425 (GRCm39) missense possibly damaging 0.90
R4611:Gpr37 UTSW 6 25,669,623 (GRCm39) missense probably benign 0.09
R4734:Gpr37 UTSW 6 25,689,085 (GRCm39) missense possibly damaging 0.53
R4765:Gpr37 UTSW 6 25,669,107 (GRCm39) missense probably damaging 1.00
R5163:Gpr37 UTSW 6 25,669,614 (GRCm39) missense possibly damaging 0.87
R5669:Gpr37 UTSW 6 25,669,351 (GRCm39) missense probably benign 0.05
R6548:Gpr37 UTSW 6 25,688,812 (GRCm39) missense probably benign 0.32
R6760:Gpr37 UTSW 6 25,669,168 (GRCm39) missense probably benign 0.00
R7030:Gpr37 UTSW 6 25,689,004 (GRCm39) missense possibly damaging 0.92
R7278:Gpr37 UTSW 6 25,669,341 (GRCm39) missense possibly damaging 0.68
R7392:Gpr37 UTSW 6 25,688,786 (GRCm39) missense probably benign 0.34
R7726:Gpr37 UTSW 6 25,669,116 (GRCm39) missense possibly damaging 0.94
R7754:Gpr37 UTSW 6 25,689,049 (GRCm39) missense probably damaging 0.99
R7757:Gpr37 UTSW 6 25,688,207 (GRCm39) missense probably benign 0.26
R8344:Gpr37 UTSW 6 25,669,530 (GRCm39) missense probably damaging 1.00
R8734:Gpr37 UTSW 6 25,688,201 (GRCm39) missense probably benign 0.17
R8839:Gpr37 UTSW 6 25,669,369 (GRCm39) missense probably benign 0.15
V7732:Gpr37 UTSW 6 25,669,122 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTTCAGCAATGAGTCCCCACAG -3'
(R):5'- TGGAAACAAGCGGCAGATCCATC -3'

Sequencing Primer
(F):5'- AAAGTGGACATCTCCCTGCG -3'
(R):5'- CGGCAGATCCATCTAGAGAGC -3'
Posted On 2013-04-24