Incidental Mutation 'R3919:Stat4'
ID 306873
Institutional Source Beutler Lab
Gene Symbol Stat4
Ensembl Gene ENSMUSG00000062939
Gene Name signal transducer and activator of transcription 4
Synonyms
MMRRC Submission 040817-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R3919 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 52026307-52146348 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 52135981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 430 (T430I)
Ref Sequence ENSEMBL: ENSMUSP00000130713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000027277
AA Change: T430I

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: T430I

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 140 314 2.2e-54 PFAM
Pfam:STAT_bind 316 562 4.7e-76 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168302
AA Change: T430I

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: T430I

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 137 314 8.2e-66 PFAM
Pfam:STAT_bind 316 563 3.3e-114 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185516
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 43,879,852 (GRCm39) probably benign Het
4930567H17Rik C T X: 69,438,135 (GRCm39) A53T probably benign Het
Abcb5 A G 12: 118,854,353 (GRCm39) M854T possibly damaging Het
Akap9 T A 5: 4,011,764 (GRCm39) Y822* probably null Het
Apoe T C 7: 19,430,472 (GRCm39) T257A probably benign Het
Atm C A 9: 53,403,578 (GRCm39) A1365S probably benign Het
Bmp2k T C 5: 97,222,599 (GRCm39) S674P unknown Het
Cd177 T C 7: 24,443,858 (GRCm39) S747G probably benign Het
Cdk5rap2 A G 4: 70,298,460 (GRCm39) F91L possibly damaging Het
Chil4 A T 3: 106,109,848 (GRCm39) N388K probably benign Het
Dnah3 G A 7: 119,550,303 (GRCm39) L3328F probably damaging Het
Dysf G A 6: 84,163,491 (GRCm39) probably null Het
Ercc5 C A 1: 44,201,091 (GRCm39) T217K probably damaging Het
Esyt1 T A 10: 128,356,905 (GRCm39) probably benign Het
Ifih1 C A 2: 62,453,845 (GRCm39) probably benign Het
Ints12 A T 3: 132,806,444 (GRCm39) T124S probably benign Het
Kdm5d T C Y: 939,914 (GRCm39) L1022P probably damaging Het
Lama2 T A 10: 26,994,501 (GRCm39) N1803Y probably damaging Het
Lpcat2 C T 8: 93,640,902 (GRCm39) T449I probably damaging Het
Ly6c2 A T 15: 74,980,613 (GRCm39) probably null Het
Mast3 T C 8: 71,232,066 (GRCm39) K1304E probably benign Het
Mdm4 T C 1: 132,922,306 (GRCm39) K279E possibly damaging Het
Mest G A 6: 30,742,749 (GRCm39) S132N probably benign Het
Mras T A 9: 99,293,473 (GRCm39) I56F probably damaging Het
Mrgprb1 T C 7: 48,097,829 (GRCm39) K28E probably benign Het
Myrip G A 9: 120,261,695 (GRCm39) G436D probably damaging Het
Nr2e3 T A 9: 59,850,723 (GRCm39) T379S probably damaging Het
Or8k27 A G 2: 86,275,762 (GRCm39) V188A probably benign Het
Plscr3 T A 11: 69,738,236 (GRCm39) probably benign Het
Pola1 C A X: 92,505,078 (GRCm39) R1313L probably benign Het
Ppt2 T C 17: 34,841,897 (GRCm39) N213S probably damaging Het
Prelid2 T A 18: 42,070,740 (GRCm39) D31V possibly damaging Het
Psmb9 C T 17: 34,402,588 (GRCm39) probably null Het
Rec8 A G 14: 55,858,716 (GRCm39) T164A probably benign Het
Rnf103 G A 6: 71,487,331 (GRCm39) R654Q probably benign Het
Setdb2 T A 14: 59,656,616 (GRCm39) I250F probably damaging Het
Slurp1 A T 15: 74,598,659 (GRCm39) *111K probably null Het
Sphkap T G 1: 83,254,179 (GRCm39) E903A probably damaging Het
Sst T C 16: 23,708,591 (GRCm39) D80G possibly damaging Het
Tmprss4 C T 9: 45,091,964 (GRCm39) V174M probably benign Het
Trim6 A T 7: 103,882,057 (GRCm39) Y436F probably damaging Het
Ttc28 C A 5: 111,433,245 (GRCm39) A2093E possibly damaging Het
Vav3 A G 3: 109,434,854 (GRCm39) N462D possibly damaging Het
Whrn G T 4: 63,413,421 (GRCm39) S17* probably null Het
Zfhx4 T A 3: 5,464,175 (GRCm39) S1469R possibly damaging Het
Zfp108 T A 7: 23,960,257 (GRCm39) C283S probably damaging Het
Other mutations in Stat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Stat4 APN 1 52,142,037 (GRCm39) missense probably damaging 1.00
IGL00482:Stat4 APN 1 52,113,856 (GRCm39) missense probably benign 0.05
IGL01395:Stat4 APN 1 52,051,033 (GRCm39) missense probably damaging 1.00
IGL01533:Stat4 APN 1 52,137,578 (GRCm39) missense probably damaging 1.00
IGL01943:Stat4 APN 1 52,136,014 (GRCm39) missense possibly damaging 0.94
IGL02114:Stat4 APN 1 52,142,024 (GRCm39) missense probably damaging 1.00
IGL02151:Stat4 APN 1 52,053,029 (GRCm39) missense probably damaging 0.99
IGL02601:Stat4 APN 1 52,137,574 (GRCm39) missense probably damaging 1.00
R0016:Stat4 UTSW 1 52,107,939 (GRCm39) missense probably benign 0.01
R0243:Stat4 UTSW 1 52,051,016 (GRCm39) missense probably benign 0.22
R0329:Stat4 UTSW 1 52,130,029 (GRCm39) intron probably benign
R0973:Stat4 UTSW 1 52,135,979 (GRCm39) missense probably damaging 0.99
R1144:Stat4 UTSW 1 52,123,288 (GRCm39) splice site probably benign
R1187:Stat4 UTSW 1 52,115,836 (GRCm39) missense probably damaging 1.00
R1331:Stat4 UTSW 1 52,053,086 (GRCm39) missense probably benign 0.20
R1401:Stat4 UTSW 1 52,111,106 (GRCm39) splice site probably benign
R1529:Stat4 UTSW 1 52,050,952 (GRCm39) missense probably damaging 1.00
R1711:Stat4 UTSW 1 52,146,084 (GRCm39) missense probably damaging 1.00
R2213:Stat4 UTSW 1 52,053,014 (GRCm39) missense probably damaging 0.98
R3003:Stat4 UTSW 1 52,142,145 (GRCm39) missense probably damaging 1.00
R3683:Stat4 UTSW 1 52,052,981 (GRCm39) missense possibly damaging 0.89
R3789:Stat4 UTSW 1 52,050,955 (GRCm39) missense probably benign 0.07
R4320:Stat4 UTSW 1 52,113,866 (GRCm39) missense probably benign
R4373:Stat4 UTSW 1 52,111,100 (GRCm39) critical splice donor site probably null
R5024:Stat4 UTSW 1 52,121,729 (GRCm39) missense possibly damaging 0.80
R5103:Stat4 UTSW 1 52,111,054 (GRCm39) missense probably damaging 0.97
R5206:Stat4 UTSW 1 52,144,395 (GRCm39) missense probably damaging 0.99
R5944:Stat4 UTSW 1 52,113,898 (GRCm39) missense probably damaging 1.00
R5961:Stat4 UTSW 1 52,104,543 (GRCm39) missense possibly damaging 0.50
R6001:Stat4 UTSW 1 52,136,026 (GRCm39) missense probably damaging 0.96
R6161:Stat4 UTSW 1 52,113,836 (GRCm39) missense possibly damaging 0.94
R6262:Stat4 UTSW 1 52,141,360 (GRCm39) missense probably null 1.00
R6701:Stat4 UTSW 1 52,142,133 (GRCm39) missense probably damaging 1.00
R6767:Stat4 UTSW 1 52,115,742 (GRCm39) missense probably benign 0.00
R6989:Stat4 UTSW 1 52,107,974 (GRCm39) missense probably benign 0.09
R7507:Stat4 UTSW 1 52,117,733 (GRCm39) missense probably damaging 1.00
R7539:Stat4 UTSW 1 52,110,868 (GRCm39) splice site probably null
R7546:Stat4 UTSW 1 52,137,622 (GRCm39) missense probably damaging 0.98
R7616:Stat4 UTSW 1 52,053,037 (GRCm39) nonsense probably null
R7751:Stat4 UTSW 1 52,121,711 (GRCm39) missense possibly damaging 0.73
R8052:Stat4 UTSW 1 52,118,932 (GRCm39) missense probably damaging 1.00
R8311:Stat4 UTSW 1 52,142,075 (GRCm39) missense probably damaging 1.00
R8419:Stat4 UTSW 1 52,137,637 (GRCm39) missense possibly damaging 0.89
R8679:Stat4 UTSW 1 52,118,991 (GRCm39) missense probably null 1.00
R8699:Stat4 UTSW 1 52,111,096 (GRCm39) missense probably benign
R8738:Stat4 UTSW 1 52,115,711 (GRCm39) missense possibly damaging 0.95
R8921:Stat4 UTSW 1 52,144,892 (GRCm39) missense probably benign 0.39
R9013:Stat4 UTSW 1 52,050,957 (GRCm39) missense probably benign 0.00
R9237:Stat4 UTSW 1 52,146,073 (GRCm39) missense probably benign
R9729:Stat4 UTSW 1 52,141,762 (GRCm39) missense possibly damaging 0.94
R9767:Stat4 UTSW 1 52,141,653 (GRCm39) missense probably damaging 1.00
Z1177:Stat4 UTSW 1 52,137,644 (GRCm39) missense probably null 1.00
Z1177:Stat4 UTSW 1 52,123,258 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGAGGGGTCTTGATTTCTCTTC -3'
(R):5'- CACAAGAGTCATGGAGTCTTTATC -3'

Sequencing Primer
(F):5'- GCAAGAACTCATGTTTTGGAAACTG -3'
(R):5'- GAGTCATGGAGTCTTTATCATTCTTC -3'
Posted On 2015-04-17