Incidental Mutation 'R3919:Sphkap'
ID 306874
Institutional Source Beutler Lab
Gene Symbol Sphkap
Ensembl Gene ENSMUSG00000026163
Gene Name SPHK1 interactor, AKAP domain containing
Synonyms SKIP, A930009L15Rik, 4930544G21Rik
MMRRC Submission 040817-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R3919 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 83233163-83385853 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 83254179 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 903 (E903A)
Ref Sequence ENSEMBL: ENSMUSP00000124384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053075
Predicted Effect probably damaging
Transcript: ENSMUST00000159078
AA Change: E903A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: E903A

DomainStartEndE-ValueType
low complexity region 303 314 N/A INTRINSIC
SCOP:d1ash__ 382 462 5e-3 SMART
low complexity region 809 819 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
low complexity region 1202 1221 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
Pfam:AKAP_110 1281 1398 7.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160953
AA Change: E1190A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: E1190A

DomainStartEndE-ValueType
low complexity region 590 601 N/A INTRINSIC
SCOP:d1ash__ 669 749 6e-3 SMART
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
Pfam:AKAP_110 1540 1655 6.4e-12 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 43,879,852 (GRCm39) probably benign Het
4930567H17Rik C T X: 69,438,135 (GRCm39) A53T probably benign Het
Abcb5 A G 12: 118,854,353 (GRCm39) M854T possibly damaging Het
Akap9 T A 5: 4,011,764 (GRCm39) Y822* probably null Het
Apoe T C 7: 19,430,472 (GRCm39) T257A probably benign Het
Atm C A 9: 53,403,578 (GRCm39) A1365S probably benign Het
Bmp2k T C 5: 97,222,599 (GRCm39) S674P unknown Het
Cd177 T C 7: 24,443,858 (GRCm39) S747G probably benign Het
Cdk5rap2 A G 4: 70,298,460 (GRCm39) F91L possibly damaging Het
Chil4 A T 3: 106,109,848 (GRCm39) N388K probably benign Het
Dnah3 G A 7: 119,550,303 (GRCm39) L3328F probably damaging Het
Dysf G A 6: 84,163,491 (GRCm39) probably null Het
Ercc5 C A 1: 44,201,091 (GRCm39) T217K probably damaging Het
Esyt1 T A 10: 128,356,905 (GRCm39) probably benign Het
Ifih1 C A 2: 62,453,845 (GRCm39) probably benign Het
Ints12 A T 3: 132,806,444 (GRCm39) T124S probably benign Het
Kdm5d T C Y: 939,914 (GRCm39) L1022P probably damaging Het
Lama2 T A 10: 26,994,501 (GRCm39) N1803Y probably damaging Het
Lpcat2 C T 8: 93,640,902 (GRCm39) T449I probably damaging Het
Ly6c2 A T 15: 74,980,613 (GRCm39) probably null Het
Mast3 T C 8: 71,232,066 (GRCm39) K1304E probably benign Het
Mdm4 T C 1: 132,922,306 (GRCm39) K279E possibly damaging Het
Mest G A 6: 30,742,749 (GRCm39) S132N probably benign Het
Mras T A 9: 99,293,473 (GRCm39) I56F probably damaging Het
Mrgprb1 T C 7: 48,097,829 (GRCm39) K28E probably benign Het
Myrip G A 9: 120,261,695 (GRCm39) G436D probably damaging Het
Nr2e3 T A 9: 59,850,723 (GRCm39) T379S probably damaging Het
Or8k27 A G 2: 86,275,762 (GRCm39) V188A probably benign Het
Plscr3 T A 11: 69,738,236 (GRCm39) probably benign Het
Pola1 C A X: 92,505,078 (GRCm39) R1313L probably benign Het
Ppt2 T C 17: 34,841,897 (GRCm39) N213S probably damaging Het
Prelid2 T A 18: 42,070,740 (GRCm39) D31V possibly damaging Het
Psmb9 C T 17: 34,402,588 (GRCm39) probably null Het
Rec8 A G 14: 55,858,716 (GRCm39) T164A probably benign Het
Rnf103 G A 6: 71,487,331 (GRCm39) R654Q probably benign Het
Setdb2 T A 14: 59,656,616 (GRCm39) I250F probably damaging Het
Slurp1 A T 15: 74,598,659 (GRCm39) *111K probably null Het
Sst T C 16: 23,708,591 (GRCm39) D80G possibly damaging Het
Stat4 C T 1: 52,135,981 (GRCm39) T430I possibly damaging Het
Tmprss4 C T 9: 45,091,964 (GRCm39) V174M probably benign Het
Trim6 A T 7: 103,882,057 (GRCm39) Y436F probably damaging Het
Ttc28 C A 5: 111,433,245 (GRCm39) A2093E possibly damaging Het
Vav3 A G 3: 109,434,854 (GRCm39) N462D possibly damaging Het
Whrn G T 4: 63,413,421 (GRCm39) S17* probably null Het
Zfhx4 T A 3: 5,464,175 (GRCm39) S1469R possibly damaging Het
Zfp108 T A 7: 23,960,257 (GRCm39) C283S probably damaging Het
Other mutations in Sphkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sphkap APN 1 83,258,237 (GRCm39) missense probably damaging 1.00
IGL00337:Sphkap APN 1 83,317,329 (GRCm39) missense probably damaging 1.00
IGL00470:Sphkap APN 1 83,255,631 (GRCm39) missense possibly damaging 0.87
IGL00577:Sphkap APN 1 83,256,565 (GRCm39) missense probably damaging 1.00
IGL00657:Sphkap APN 1 83,254,096 (GRCm39) missense probably damaging 1.00
IGL01868:Sphkap APN 1 83,258,120 (GRCm39) splice site probably null
IGL02101:Sphkap APN 1 83,268,708 (GRCm39) missense probably damaging 1.00
IGL02471:Sphkap APN 1 83,253,897 (GRCm39) missense probably damaging 1.00
IGL02943:Sphkap APN 1 83,254,552 (GRCm39) missense probably damaging 1.00
IGL02945:Sphkap APN 1 83,254,552 (GRCm39) missense probably damaging 1.00
IGL03008:Sphkap APN 1 83,254,552 (GRCm39) missense probably damaging 1.00
IGL03031:Sphkap APN 1 83,254,552 (GRCm39) missense probably damaging 1.00
IGL03059:Sphkap APN 1 83,234,963 (GRCm39) missense probably damaging 0.97
IGL03085:Sphkap APN 1 83,258,075 (GRCm39) missense possibly damaging 0.92
IGL03355:Sphkap APN 1 83,258,224 (GRCm39) missense probably damaging 1.00
IGL03356:Sphkap APN 1 83,254,552 (GRCm39) missense probably damaging 1.00
IGL03368:Sphkap APN 1 83,253,397 (GRCm39) missense probably benign 0.14
R0294:Sphkap UTSW 1 83,255,966 (GRCm39) missense possibly damaging 0.72
R0308:Sphkap UTSW 1 83,254,690 (GRCm39) missense probably damaging 1.00
R0478:Sphkap UTSW 1 83,256,432 (GRCm39) missense probably damaging 1.00
R0606:Sphkap UTSW 1 83,258,145 (GRCm39) missense probably damaging 1.00
R0678:Sphkap UTSW 1 83,256,349 (GRCm39) missense probably benign 0.03
R1216:Sphkap UTSW 1 83,268,698 (GRCm39) missense probably damaging 1.00
R1253:Sphkap UTSW 1 83,256,619 (GRCm39) missense possibly damaging 0.56
R1532:Sphkap UTSW 1 83,234,924 (GRCm39) missense probably damaging 1.00
R1635:Sphkap UTSW 1 83,256,121 (GRCm39) missense probably benign 0.03
R1655:Sphkap UTSW 1 83,255,236 (GRCm39) nonsense probably null
R1657:Sphkap UTSW 1 83,255,236 (GRCm39) nonsense probably null
R1700:Sphkap UTSW 1 83,255,236 (GRCm39) nonsense probably null
R1701:Sphkap UTSW 1 83,255,236 (GRCm39) nonsense probably null
R1734:Sphkap UTSW 1 83,255,236 (GRCm39) nonsense probably null
R1736:Sphkap UTSW 1 83,255,236 (GRCm39) nonsense probably null
R1743:Sphkap UTSW 1 83,255,236 (GRCm39) nonsense probably null
R1744:Sphkap UTSW 1 83,255,236 (GRCm39) nonsense probably null
R1760:Sphkap UTSW 1 83,255,265 (GRCm39) missense probably benign 0.29
R1893:Sphkap UTSW 1 83,256,687 (GRCm39) missense probably benign 0.02
R1937:Sphkap UTSW 1 83,245,162 (GRCm39) nonsense probably null
R1986:Sphkap UTSW 1 83,255,643 (GRCm39) missense probably damaging 1.00
R1993:Sphkap UTSW 1 83,255,236 (GRCm39) nonsense probably null
R1995:Sphkap UTSW 1 83,255,236 (GRCm39) nonsense probably null
R2001:Sphkap UTSW 1 83,254,383 (GRCm39) missense probably damaging 1.00
R2004:Sphkap UTSW 1 83,255,632 (GRCm39) missense probably benign 0.04
R2111:Sphkap UTSW 1 83,253,602 (GRCm39) missense probably benign 0.00
R2112:Sphkap UTSW 1 83,253,602 (GRCm39) missense probably benign 0.00
R2156:Sphkap UTSW 1 83,255,710 (GRCm39) missense probably benign 0.03
R2182:Sphkap UTSW 1 83,254,405 (GRCm39) missense probably damaging 1.00
R2271:Sphkap UTSW 1 83,234,942 (GRCm39) missense probably damaging 1.00
R3712:Sphkap UTSW 1 83,254,833 (GRCm39) missense probably benign 0.27
R3980:Sphkap UTSW 1 83,245,215 (GRCm39) splice site probably null
R4130:Sphkap UTSW 1 83,255,619 (GRCm39) missense probably damaging 0.96
R4539:Sphkap UTSW 1 83,255,514 (GRCm39) missense probably benign 0.00
R4602:Sphkap UTSW 1 83,256,782 (GRCm39) nonsense probably null
R4735:Sphkap UTSW 1 83,256,838 (GRCm39) missense probably benign 0.01
R4793:Sphkap UTSW 1 83,255,805 (GRCm39) missense possibly damaging 0.77
R4849:Sphkap UTSW 1 83,255,105 (GRCm39) missense probably benign 0.03
R4880:Sphkap UTSW 1 83,266,538 (GRCm39) missense probably damaging 1.00
R5213:Sphkap UTSW 1 83,258,224 (GRCm39) missense probably damaging 1.00
R5277:Sphkap UTSW 1 83,253,885 (GRCm39) missense probably benign 0.04
R5331:Sphkap UTSW 1 83,254,503 (GRCm39) missense probably benign 0.08
R5632:Sphkap UTSW 1 83,256,006 (GRCm39) missense probably benign 0.01
R5647:Sphkap UTSW 1 83,385,720 (GRCm39) missense probably damaging 0.98
R5751:Sphkap UTSW 1 83,253,618 (GRCm39) missense probably benign 0.27
R5935:Sphkap UTSW 1 83,317,320 (GRCm39) missense probably damaging 1.00
R5999:Sphkap UTSW 1 83,245,126 (GRCm39) missense probably benign 0.02
R6232:Sphkap UTSW 1 83,258,200 (GRCm39) missense probably damaging 1.00
R6318:Sphkap UTSW 1 83,256,099 (GRCm39) missense probably damaging 1.00
R6474:Sphkap UTSW 1 83,256,544 (GRCm39) missense probably damaging 1.00
R6602:Sphkap UTSW 1 83,253,479 (GRCm39) missense possibly damaging 0.75
R6674:Sphkap UTSW 1 83,255,555 (GRCm39) missense probably benign 0.37
R6716:Sphkap UTSW 1 83,339,949 (GRCm39) critical splice donor site probably null
R6803:Sphkap UTSW 1 83,258,231 (GRCm39) missense probably damaging 1.00
R6880:Sphkap UTSW 1 83,234,978 (GRCm39) missense probably damaging 1.00
R6941:Sphkap UTSW 1 83,385,811 (GRCm39) start gained probably benign
R7170:Sphkap UTSW 1 83,243,706 (GRCm39) missense probably damaging 0.99
R7263:Sphkap UTSW 1 83,254,399 (GRCm39) missense probably damaging 1.00
R7422:Sphkap UTSW 1 83,241,547 (GRCm39) missense probably benign 0.02
R7640:Sphkap UTSW 1 83,256,649 (GRCm39) missense possibly damaging 0.94
R7722:Sphkap UTSW 1 83,256,642 (GRCm39) missense probably benign 0.00
R7810:Sphkap UTSW 1 83,254,021 (GRCm39) missense probably damaging 1.00
R7887:Sphkap UTSW 1 83,255,133 (GRCm39) missense probably benign 0.00
R7974:Sphkap UTSW 1 83,256,683 (GRCm39) missense probably damaging 1.00
R7990:Sphkap UTSW 1 83,245,066 (GRCm39) missense probably damaging 0.99
R8096:Sphkap UTSW 1 83,255,279 (GRCm39) missense probably damaging 0.98
R8110:Sphkap UTSW 1 83,256,492 (GRCm39) missense possibly damaging 0.82
R8125:Sphkap UTSW 1 83,241,303 (GRCm39) missense probably damaging 1.00
R8153:Sphkap UTSW 1 83,255,730 (GRCm39) missense possibly damaging 0.93
R8245:Sphkap UTSW 1 83,256,492 (GRCm39) missense probably benign 0.14
R8394:Sphkap UTSW 1 83,253,797 (GRCm39) missense probably benign 0.08
R8443:Sphkap UTSW 1 83,255,953 (GRCm39) missense probably benign 0.00
R8508:Sphkap UTSW 1 83,254,221 (GRCm39) missense probably damaging 1.00
R8531:Sphkap UTSW 1 83,254,909 (GRCm39) missense probably damaging 1.00
R8673:Sphkap UTSW 1 83,253,561 (GRCm39) missense probably benign 0.01
R8674:Sphkap UTSW 1 83,255,565 (GRCm39) missense probably benign 0.04
R8682:Sphkap UTSW 1 83,256,997 (GRCm39) missense probably benign 0.21
R8837:Sphkap UTSW 1 83,253,384 (GRCm39) missense possibly damaging 0.87
R8857:Sphkap UTSW 1 83,258,288 (GRCm39) missense probably damaging 1.00
R8902:Sphkap UTSW 1 83,256,685 (GRCm39) missense probably benign 0.21
R8916:Sphkap UTSW 1 83,255,108 (GRCm39) missense possibly damaging 0.87
R8944:Sphkap UTSW 1 83,256,927 (GRCm39) missense probably benign 0.39
R9154:Sphkap UTSW 1 83,234,982 (GRCm39) missense probably damaging 1.00
R9579:Sphkap UTSW 1 83,255,295 (GRCm39) missense probably damaging 0.99
R9616:Sphkap UTSW 1 83,254,989 (GRCm39) missense probably damaging 1.00
R9781:Sphkap UTSW 1 83,255,772 (GRCm39) missense possibly damaging 0.62
Z1088:Sphkap UTSW 1 83,256,325 (GRCm39) missense probably damaging 1.00
Z1088:Sphkap UTSW 1 83,254,329 (GRCm39) missense probably damaging 1.00
Z1176:Sphkap UTSW 1 83,258,163 (GRCm39) missense possibly damaging 0.61
Z1176:Sphkap UTSW 1 83,253,754 (GRCm39) nonsense probably null
Z1177:Sphkap UTSW 1 83,254,152 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGATGAGGAAGCCCTACTGAC -3'
(R):5'- TGCTGGATTACTACGCAGGC -3'

Sequencing Primer
(F):5'- AAGCCCTACTGACTGGCTGTAC -3'
(R):5'- CTGGATTACTACGCAGGCAAAAATG -3'
Posted On 2015-04-17