Mutagenetix > Incidental Mutation

Incidental Mutation 'R3919:Sphkap'

306874

Institutional Source

Beutler Lab

Gene Symbol

Sphkap

Ensembl Gene

ENSMUSG00000026163

Gene Name

SPHK1 interactor, AKAP domain containing

Synonyms

4930544G21Rik, A930009L15Rik, SKIP

MMRRC Submission

040817-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R3919 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83254139-83408200 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 83276458 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 903 (E903A)

Ref Sequence

ENSEMBL: ENSMUSP00000124384 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000053075

Predicted Effect

probably damaging
Transcript: ENSMUST00000159078
AA Change: E903A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: E903A

Domain	Start	End	E-Value	Type
low complexity region	303	314	N/A	INTRINSIC
SCOP:d1ash__	382	462	5e-3	SMART
low complexity region	809	819	N/A	INTRINSIC
low complexity region	854	865	N/A	INTRINSIC
low complexity region	1202	1221	N/A	INTRINSIC
low complexity region	1243	1254	N/A	INTRINSIC
Pfam:AKAP_110	1281	1398	7.5e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000160953
AA Change: E1190A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: E1190A

Domain	Start	End	E-Value	Type
low complexity region	590	601	N/A	INTRINSIC
SCOP:d1ash__	669	749	6e-3	SMART
low complexity region	1096	1106	N/A	INTRINSIC
low complexity region	1141	1152	N/A	INTRINSIC
low complexity region	1489	1508	N/A	INTRINSIC
Pfam:AKAP_110	1540	1655	6.4e-12	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (49/50)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028J19Rik	G	T	7: 44,230,428		probably benign	Het
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
Abcb5	A	G	12: 118,890,618	M854T	possibly damaging	Het
Akap9	T	A	5: 3,961,764	Y822*	probably null	Het
Apoe	T	C	7: 19,696,547	T257A	probably benign	Het
Atm	C	A	9: 53,492,278	A1365S	probably benign	Het
Bmp2k	T	C	5: 97,074,740	S674P	unknown	Het
Cd177	T	C	7: 24,744,433	S747G	probably benign	Het
Cdk5rap2	A	G	4: 70,380,223	F91L	possibly damaging	Het
Chil4	A	T	3: 106,202,532	N388K	probably benign	Het
Dnah3	G	A	7: 119,951,080	L3328F	probably damaging	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Ercc5	C	A	1: 44,161,931	T217K	probably damaging	Het
Esyt1	T	A	10: 128,521,036		probably benign	Het
Ifih1	C	A	2: 62,623,501		probably benign	Het
Ints12	A	T	3: 133,100,683	T124S	probably benign	Het
Kdm5d	T	C	Y: 939,914	L1022P	probably damaging	Het
Lama2	T	A	10: 27,118,505	N1803Y	probably damaging	Het
Lpcat2	C	T	8: 92,914,274	T449I	probably damaging	Het
Ly6c2	A	T	15: 75,108,764		probably null	Het
Mast3	T	C	8: 70,779,422	K1304E	probably benign	Het
Mdm4	T	C	1: 132,994,568	K279E	possibly damaging	Het
Mest	G	A	6: 30,742,750	S132N	probably benign	Het
Mras	T	A	9: 99,411,420	I56F	probably damaging	Het
Mrgprb1	T	C	7: 48,448,081	K28E	probably benign	Het
Myrip	G	A	9: 120,432,629	G436D	probably damaging	Het
Nr2e3	T	A	9: 59,943,440	T379S	probably damaging	Het
Olfr1065	A	G	2: 86,445,418	V188A	probably benign	Het
Plscr3	T	A	11: 69,847,410		probably benign	Het
Pola1	C	A	X: 93,461,472	R1313L	probably benign	Het
Ppt2	T	C	17: 34,622,923	N213S	probably damaging	Het
Prelid2	T	A	18: 41,937,675	D31V	possibly damaging	Het
Psmb9	C	T	17: 34,183,614		probably null	Het
Rec8	A	G	14: 55,621,259	T164A	probably benign	Het
Rnf103	G	A	6: 71,510,347	R654Q	probably benign	Het
Setdb2	T	A	14: 59,419,167	I250F	probably damaging	Het
Slurp1	A	T	15: 74,726,810	*111K	probably null	Het
Sst	T	C	16: 23,889,841	D80G	possibly damaging	Het
Stat4	C	T	1: 52,096,822	T430I	possibly damaging	Het
Tmprss4	C	T	9: 45,180,666	V174M	probably benign	Het
Trim6	A	T	7: 104,232,850	Y436F	probably damaging	Het
Ttc28	C	A	5: 111,285,379	A2093E	possibly damaging	Het
Vav3	A	G	3: 109,527,538	N462D	possibly damaging	Het
Whrn	G	T	4: 63,495,184	S17*	probably null	Het
Zfhx4	T	A	3: 5,399,115	S1469R	possibly damaging	Het
Zfp108	T	A	7: 24,260,832	C283S	probably damaging	Het

Other mutations in Sphkap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Sphkap	APN	1	83280516	missense	probably damaging	1.00
IGL00337:Sphkap	APN	1	83339608	missense	probably damaging	1.00
IGL00470:Sphkap	APN	1	83277910	missense	possibly damaging	0.87
IGL00577:Sphkap	APN	1	83278844	missense	probably damaging	1.00
IGL00657:Sphkap	APN	1	83276375	missense	probably damaging	1.00
IGL01868:Sphkap	APN	1	83280399	splice site	probably null
IGL02101:Sphkap	APN	1	83290987	missense	probably damaging	1.00
IGL02471:Sphkap	APN	1	83276176	missense	probably damaging	1.00
IGL02943:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL02945:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03008:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03031:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03059:Sphkap	APN	1	83257242	missense	probably damaging	0.97
IGL03085:Sphkap	APN	1	83280354	missense	possibly damaging	0.92
IGL03355:Sphkap	APN	1	83280503	missense	probably damaging	1.00
IGL03356:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03368:Sphkap	APN	1	83275676	missense	probably benign	0.14
R0294:Sphkap	UTSW	1	83278245	missense	possibly damaging	0.72
R0308:Sphkap	UTSW	1	83276969	missense	probably damaging	1.00
R0478:Sphkap	UTSW	1	83278711	missense	probably damaging	1.00
R0606:Sphkap	UTSW	1	83280424	missense	probably damaging	1.00
R0678:Sphkap	UTSW	1	83278628	missense	probably benign	0.03
R1216:Sphkap	UTSW	1	83290977	missense	probably damaging	1.00
R1253:Sphkap	UTSW	1	83278898	missense	possibly damaging	0.56
R1532:Sphkap	UTSW	1	83257203	missense	probably damaging	1.00
R1635:Sphkap	UTSW	1	83278400	missense	probably benign	0.03
R1655:Sphkap	UTSW	1	83277515	nonsense	probably null
R1657:Sphkap	UTSW	1	83277515	nonsense	probably null
R1700:Sphkap	UTSW	1	83277515	nonsense	probably null
R1701:Sphkap	UTSW	1	83277515	nonsense	probably null
R1734:Sphkap	UTSW	1	83277515	nonsense	probably null
R1736:Sphkap	UTSW	1	83277515	nonsense	probably null
R1743:Sphkap	UTSW	1	83277515	nonsense	probably null
R1744:Sphkap	UTSW	1	83277515	nonsense	probably null
R1760:Sphkap	UTSW	1	83277544	missense	probably benign	0.29
R1893:Sphkap	UTSW	1	83278966	missense	probably benign	0.02
R1937:Sphkap	UTSW	1	83267441	nonsense	probably null
R1986:Sphkap	UTSW	1	83277922	missense	probably damaging	1.00
R1993:Sphkap	UTSW	1	83277515	nonsense	probably null
R1995:Sphkap	UTSW	1	83277515	nonsense	probably null
R2001:Sphkap	UTSW	1	83276662	missense	probably damaging	1.00
R2004:Sphkap	UTSW	1	83277911	missense	probably benign	0.04
R2111:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2112:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2156:Sphkap	UTSW	1	83277989	missense	probably benign	0.03
R2182:Sphkap	UTSW	1	83276684	missense	probably damaging	1.00
R2271:Sphkap	UTSW	1	83257221	missense	probably damaging	1.00
R3712:Sphkap	UTSW	1	83277112	missense	probably benign	0.27
R3980:Sphkap	UTSW	1	83267494	splice site	probably null
R4130:Sphkap	UTSW	1	83277898	missense	probably damaging	0.96
R4539:Sphkap	UTSW	1	83277793	missense	probably benign	0.00
R4602:Sphkap	UTSW	1	83279061	nonsense	probably null
R4735:Sphkap	UTSW	1	83279117	missense	probably benign	0.01
R4793:Sphkap	UTSW	1	83278084	missense	possibly damaging	0.77
R4849:Sphkap	UTSW	1	83277384	missense	probably benign	0.03
R4880:Sphkap	UTSW	1	83288817	missense	probably damaging	1.00
R5213:Sphkap	UTSW	1	83280503	missense	probably damaging	1.00
R5277:Sphkap	UTSW	1	83276164	missense	probably benign	0.04
R5331:Sphkap	UTSW	1	83276782	missense	probably benign	0.08
R5632:Sphkap	UTSW	1	83278285	missense	probably benign	0.01
R5647:Sphkap	UTSW	1	83407999	missense	probably damaging	0.98
R5751:Sphkap	UTSW	1	83275897	missense	probably benign	0.27
R5935:Sphkap	UTSW	1	83339599	missense	probably damaging	1.00
R5999:Sphkap	UTSW	1	83267405	missense	probably benign	0.02
R6232:Sphkap	UTSW	1	83280479	missense	probably damaging	1.00
R6318:Sphkap	UTSW	1	83278378	missense	probably damaging	1.00
R6474:Sphkap	UTSW	1	83278823	missense	probably damaging	1.00
R6602:Sphkap	UTSW	1	83275758	missense	possibly damaging	0.75
R6674:Sphkap	UTSW	1	83277834	missense	probably benign	0.37
R6716:Sphkap	UTSW	1	83362228	critical splice donor site	probably null
R6803:Sphkap	UTSW	1	83280510	missense	probably damaging	1.00
R6880:Sphkap	UTSW	1	83257257	missense	probably damaging	1.00
R6941:Sphkap	UTSW	1	83408090	start gained	probably benign
R7170:Sphkap	UTSW	1	83265985	missense	probably damaging	0.99
R7263:Sphkap	UTSW	1	83276678	missense	probably damaging	1.00
R7422:Sphkap	UTSW	1	83263826	missense	probably benign	0.02
R7640:Sphkap	UTSW	1	83278928	missense	possibly damaging	0.94
R7722:Sphkap	UTSW	1	83278921	missense	probably benign	0.00
R7810:Sphkap	UTSW	1	83276300	missense	probably damaging	1.00
R7887:Sphkap	UTSW	1	83277412	missense	probably benign	0.00
R7974:Sphkap	UTSW	1	83278962	missense	probably damaging	1.00
R7990:Sphkap	UTSW	1	83267345	missense	probably damaging	0.99
R8096:Sphkap	UTSW	1	83277558	missense	probably damaging	0.98
R8110:Sphkap	UTSW	1	83278771	missense	possibly damaging	0.82
R8125:Sphkap	UTSW	1	83263582	missense	probably damaging	1.00
R8153:Sphkap	UTSW	1	83278009	missense	possibly damaging	0.93
R8245:Sphkap	UTSW	1	83278771	missense	probably benign	0.14
R8394:Sphkap	UTSW	1	83276076	missense	probably benign	0.08
R8443:Sphkap	UTSW	1	83278232	missense	probably benign	0.00
R8508:Sphkap	UTSW	1	83276500	missense	probably damaging	1.00
R8531:Sphkap	UTSW	1	83277188	missense	probably damaging	1.00
R8673:Sphkap	UTSW	1	83275840	missense	probably benign	0.01
R8674:Sphkap	UTSW	1	83277844	missense	probably benign	0.04
R8682:Sphkap	UTSW	1	83279276	missense	probably benign	0.21
R8837:Sphkap	UTSW	1	83275663	missense	possibly damaging	0.87
R8857:Sphkap	UTSW	1	83280567	missense	probably damaging	1.00
R8902:Sphkap	UTSW	1	83278964	missense	probably benign	0.21
R8916:Sphkap	UTSW	1	83277387	missense	possibly damaging	0.87
R8944:Sphkap	UTSW	1	83279206	missense	probably benign	0.39
R9154:Sphkap	UTSW	1	83257261	missense	probably damaging	1.00
R9579:Sphkap	UTSW	1	83277574	missense	probably damaging	0.99
R9616:Sphkap	UTSW	1	83277268	missense	probably damaging	1.00
R9781:Sphkap	UTSW	1	83278051	missense	possibly damaging	0.62
Z1088:Sphkap	UTSW	1	83276608	missense	probably damaging	1.00
Z1088:Sphkap	UTSW	1	83278604	missense	probably damaging	1.00
Z1176:Sphkap	UTSW	1	83276033	nonsense	probably null
Z1176:Sphkap	UTSW	1	83280442	missense	possibly damaging	0.61
Z1177:Sphkap	UTSW	1	83276431	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGATGAGGAAGCCCTACTGAC -3'
(R):5'- TGCTGGATTACTACGCAGGC -3'

Sequencing Primer
(F):5'- AAGCCCTACTGACTGGCTGTAC -3'
(R):5'- CTGGATTACTACGCAGGCAAAAATG -3'

Posted On

2015-04-17