Incidental Mutation 'R3919:Mdm4'
ID306875
Institutional Source Beutler Lab
Gene Symbol Mdm4
Ensembl Gene ENSMUSG00000054387
Gene Nametransformed mouse 3T3 cell double minute 4
Synonyms4933417N07Rik, Mdmx
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3919 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132959484-133030561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132994568 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 279 (K279E)
Ref Sequence ENSEMBL: ENSMUSP00000140812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067398] [ENSMUST00000067429] [ENSMUST00000185398] [ENSMUST00000186617] [ENSMUST00000188090] [ENSMUST00000191212]
Predicted Effect probably benign
Transcript: ENSMUST00000067398
AA Change: K280E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000068661
Gene: ENSMUSG00000054387
AA Change: K280E

DomainStartEndE-ValueType
Pfam:SWIB 26 96 3.7e-10 PFAM
low complexity region 281 295 N/A INTRINSIC
ZnF_RBZ 302 326 1.65e-2 SMART
RING 437 477 7.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067429
AA Change: K279E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000070411
Gene: ENSMUSG00000054387
AA Change: K279E

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185398
SMART Domains Protein: ENSMUSP00000140090
Gene: ENSMUSG00000054387

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186513
Predicted Effect possibly damaging
Transcript: ENSMUST00000186617
AA Change: K279E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140812
Gene: ENSMUSG00000054387
AA Change: K279E

DomainStartEndE-ValueType
Pfam:SWIB 26 101 9.9e-15 PFAM
low complexity region 280 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188090
AA Change: K279E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000140609
Gene: ENSMUSG00000054387
AA Change: K279E

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190312
Predicted Effect probably benign
Transcript: ENSMUST00000191212
SMART Domains Protein: ENSMUSP00000140006
Gene: ENSMUSG00000054387

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.4e-15 PFAM
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of this gene or overexpression of the encoded protein has been linked to a range of human cancers. A pseudogene has been identified on the X chromosome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality, decreased cellular proliferation, and abnormal nervous system development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Mdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Mdm4 APN 1 132994547 missense probably benign 0.02
IGL03034:Mdm4 APN 1 133011071 missense probably damaging 1.00
IGL03099:Mdm4 APN 1 132992209 missense probably damaging 1.00
Isla_nublar UTSW 1 133012692 missense probably damaging 1.00
Jurassic UTSW 1 133011115 missense probably damaging 0.96
Sun_island UTSW 1 133012651 missense probably damaging 1.00
R0630:Mdm4 UTSW 1 132991753 missense possibly damaging 0.47
R1170:Mdm4 UTSW 1 132991820 missense probably damaging 1.00
R1170:Mdm4 UTSW 1 133012692 missense probably damaging 1.00
R1774:Mdm4 UTSW 1 132996646 missense probably damaging 0.99
R1920:Mdm4 UTSW 1 133003800 missense probably benign 0.06
R2061:Mdm4 UTSW 1 133012651 missense probably damaging 1.00
R2212:Mdm4 UTSW 1 132994522 missense probably damaging 1.00
R3695:Mdm4 UTSW 1 132991993 missense probably benign 0.00
R5273:Mdm4 UTSW 1 132994582 missense probably benign
R5360:Mdm4 UTSW 1 132991658 makesense probably null
R6125:Mdm4 UTSW 1 132994510 missense possibly damaging 0.95
R6153:Mdm4 UTSW 1 132992107 missense probably damaging 1.00
R7028:Mdm4 UTSW 1 133003809 missense probably benign 0.09
R7234:Mdm4 UTSW 1 133011115 missense probably damaging 0.96
R7267:Mdm4 UTSW 1 132994573 missense probably benign 0.00
Z1088:Mdm4 UTSW 1 132994547 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTTGTGTTAGCAGGGACAG -3'
(R):5'- TGCACAACATAACATTTCCTGC -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- GCACAACATAACATTTCCTGCATAGG -3'
Posted On2015-04-17