Incidental Mutation 'R3919:Chil4'
ID306879
Institutional Source Beutler Lab
Gene Symbol Chil4
Ensembl Gene ENSMUSG00000063779
Gene Namechitinase-like 4
SynonymsYm2, Chi3l4
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3919 (G1)
Quality Score103
Status Validated
Chromosome3
Chromosomal Location106201490-106219507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106202532 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 388 (N388K)
Ref Sequence ENSEMBL: ENSMUSP00000080851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082219]
Predicted Effect probably benign
Transcript: ENSMUST00000082219
AA Change: N388K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: N388K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.77e-132 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Chil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Chil4 APN 3 106201797 missense probably benign
IGL02457:Chil4 APN 3 106214399 missense probably benign
R1087:Chil4 UTSW 3 106210565 missense probably benign 0.01
R1398:Chil4 UTSW 3 106219509 unclassified probably null
R1503:Chil4 UTSW 3 106206034 missense probably benign
R1553:Chil4 UTSW 3 106203690 missense probably benign 0.02
R1806:Chil4 UTSW 3 106210643 splice site probably benign
R1873:Chil4 UTSW 3 106206098 missense probably benign 0.00
R2069:Chil4 UTSW 3 106219455 missense probably benign 0.16
R2100:Chil4 UTSW 3 106214347 missense probably benign
R2370:Chil4 UTSW 3 106214300 nonsense probably null
R2984:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R2985:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R3522:Chil4 UTSW 3 106203740 missense probably benign 0.08
R4033:Chil4 UTSW 3 106214449 missense probably damaging 1.00
R4181:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4184:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4301:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4347:Chil4 UTSW 3 106202828 missense probably benign
R4391:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4395:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4418:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4483:Chil4 UTSW 3 106214362 missense probably damaging 1.00
R4544:Chil4 UTSW 3 106210606 missense probably damaging 0.97
R4887:Chil4 UTSW 3 106204144 missense probably benign 0.01
R4949:Chil4 UTSW 3 106206092 missense possibly damaging 0.83
R5076:Chil4 UTSW 3 106202597 missense probably damaging 1.00
R5146:Chil4 UTSW 3 106202834 missense probably benign 0.18
R5254:Chil4 UTSW 3 106219452 missense probably benign 0.00
R5521:Chil4 UTSW 3 106203697 missense possibly damaging 0.50
R5790:Chil4 UTSW 3 106202578 missense probably benign 0.00
R5883:Chil4 UTSW 3 106210570 missense possibly damaging 0.48
R6010:Chil4 UTSW 3 106214395 missense probably damaging 1.00
R6257:Chil4 UTSW 3 106204096 missense possibly damaging 0.84
R6269:Chil4 UTSW 3 106204171 missense probably damaging 1.00
R6602:Chil4 UTSW 3 106210590 missense probably benign 0.00
R7113:Chil4 UTSW 3 106202767 missense probably damaging 1.00
R7113:Chil4 UTSW 3 106214348 missense probably benign
R7188:Chil4 UTSW 3 106204159 missense probably damaging 1.00
X0067:Chil4 UTSW 3 106206034 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATCAAGGTATCCCTGGTTC -3'
(R):5'- CTGAGATTGCAGCCTGATTCCC -3'

Sequencing Primer
(F):5'- CCTGGTTCCTAATAAGTGTGCAAC -3'
(R):5'- TCCCAGGAAATAAGTGACTAAATGC -3'
Posted On2015-04-17