Incidental Mutation 'R3919:Akap9'
ID 306883
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene Name A kinase anchor protein 9
Synonyms mei2-5, repro12, AKAP450, G1-448-15, 5730481H23Rik
MMRRC Submission 040817-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.436) question?
Stock # R3919 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 3977410-4130204 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 4011764 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 822 (Y822*)
Ref Sequence ENSEMBL: ENSMUSP00000046129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000143365]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000044492
AA Change: Y822*
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: Y822*

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140977
Predicted Effect probably benign
Transcript: ENSMUST00000143365
SMART Domains Protein: ENSMUSP00000117209
Gene: ENSMUSG00000040407

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Blast:HPT 144 215 9e-22 BLAST
low complexity region 255 267 N/A INTRINSIC
low complexity region 315 333 N/A INTRINSIC
coiled coil region 422 571 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177448
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 43,879,852 (GRCm39) probably benign Het
4930567H17Rik C T X: 69,438,135 (GRCm39) A53T probably benign Het
Abcb5 A G 12: 118,854,353 (GRCm39) M854T possibly damaging Het
Apoe T C 7: 19,430,472 (GRCm39) T257A probably benign Het
Atm C A 9: 53,403,578 (GRCm39) A1365S probably benign Het
Bmp2k T C 5: 97,222,599 (GRCm39) S674P unknown Het
Cd177 T C 7: 24,443,858 (GRCm39) S747G probably benign Het
Cdk5rap2 A G 4: 70,298,460 (GRCm39) F91L possibly damaging Het
Chil4 A T 3: 106,109,848 (GRCm39) N388K probably benign Het
Dnah3 G A 7: 119,550,303 (GRCm39) L3328F probably damaging Het
Dysf G A 6: 84,163,491 (GRCm39) probably null Het
Ercc5 C A 1: 44,201,091 (GRCm39) T217K probably damaging Het
Esyt1 T A 10: 128,356,905 (GRCm39) probably benign Het
Ifih1 C A 2: 62,453,845 (GRCm39) probably benign Het
Ints12 A T 3: 132,806,444 (GRCm39) T124S probably benign Het
Kdm5d T C Y: 939,914 (GRCm39) L1022P probably damaging Het
Lama2 T A 10: 26,994,501 (GRCm39) N1803Y probably damaging Het
Lpcat2 C T 8: 93,640,902 (GRCm39) T449I probably damaging Het
Ly6c2 A T 15: 74,980,613 (GRCm39) probably null Het
Mast3 T C 8: 71,232,066 (GRCm39) K1304E probably benign Het
Mdm4 T C 1: 132,922,306 (GRCm39) K279E possibly damaging Het
Mest G A 6: 30,742,749 (GRCm39) S132N probably benign Het
Mras T A 9: 99,293,473 (GRCm39) I56F probably damaging Het
Mrgprb1 T C 7: 48,097,829 (GRCm39) K28E probably benign Het
Myrip G A 9: 120,261,695 (GRCm39) G436D probably damaging Het
Nr2e3 T A 9: 59,850,723 (GRCm39) T379S probably damaging Het
Or8k27 A G 2: 86,275,762 (GRCm39) V188A probably benign Het
Plscr3 T A 11: 69,738,236 (GRCm39) probably benign Het
Pola1 C A X: 92,505,078 (GRCm39) R1313L probably benign Het
Ppt2 T C 17: 34,841,897 (GRCm39) N213S probably damaging Het
Prelid2 T A 18: 42,070,740 (GRCm39) D31V possibly damaging Het
Psmb9 C T 17: 34,402,588 (GRCm39) probably null Het
Rec8 A G 14: 55,858,716 (GRCm39) T164A probably benign Het
Rnf103 G A 6: 71,487,331 (GRCm39) R654Q probably benign Het
Setdb2 T A 14: 59,656,616 (GRCm39) I250F probably damaging Het
Slurp1 A T 15: 74,598,659 (GRCm39) *111K probably null Het
Sphkap T G 1: 83,254,179 (GRCm39) E903A probably damaging Het
Sst T C 16: 23,708,591 (GRCm39) D80G possibly damaging Het
Stat4 C T 1: 52,135,981 (GRCm39) T430I possibly damaging Het
Tmprss4 C T 9: 45,091,964 (GRCm39) V174M probably benign Het
Trim6 A T 7: 103,882,057 (GRCm39) Y436F probably damaging Het
Ttc28 C A 5: 111,433,245 (GRCm39) A2093E possibly damaging Het
Vav3 A G 3: 109,434,854 (GRCm39) N462D possibly damaging Het
Whrn G T 4: 63,413,421 (GRCm39) S17* probably null Het
Zfhx4 T A 3: 5,464,175 (GRCm39) S1469R possibly damaging Het
Zfp108 T A 7: 23,960,257 (GRCm39) C283S probably damaging Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4,096,639 (GRCm39) missense probably damaging 0.97
IGL00642:Akap9 APN 5 4,010,842 (GRCm39) missense probably damaging 0.99
IGL00786:Akap9 APN 5 4,120,522 (GRCm39) missense probably damaging 1.00
IGL00788:Akap9 APN 5 4,110,480 (GRCm39) missense probably damaging 1.00
IGL00969:Akap9 APN 5 4,051,550 (GRCm39) missense probably benign
IGL01014:Akap9 APN 5 4,018,683 (GRCm39) missense probably benign 0.41
IGL01302:Akap9 APN 5 4,020,711 (GRCm39) missense probably benign 0.27
IGL01610:Akap9 APN 5 4,082,839 (GRCm39) missense possibly damaging 0.95
IGL01620:Akap9 APN 5 4,010,218 (GRCm39) missense probably benign 0.11
IGL01862:Akap9 APN 5 4,115,856 (GRCm39) missense probably damaging 0.99
IGL01862:Akap9 APN 5 4,001,705 (GRCm39) missense probably damaging 0.99
IGL02151:Akap9 APN 5 4,082,728 (GRCm39) nonsense probably null
IGL02635:Akap9 APN 5 4,120,500 (GRCm39) missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4,119,130 (GRCm39) missense possibly damaging 0.88
IGL02967:Akap9 APN 5 4,026,164 (GRCm39) missense probably benign 0.07
IGL03064:Akap9 APN 5 4,018,755 (GRCm39) missense probably damaging 1.00
IGL03289:Akap9 APN 5 4,127,261 (GRCm39) missense probably damaging 1.00
Andy UTSW 5 4,011,764 (GRCm39) nonsense probably null
blimey UTSW 5 4,120,397 (GRCm39) nonsense probably null
hoarder UTSW 5 4,119,089 (GRCm39) missense probably benign 0.00
marinarum UTSW 5 4,063,875 (GRCm39) nonsense probably null
miser UTSW 5 4,096,064 (GRCm39) missense probably benign 0.13
naviculus UTSW 5 4,010,865 (GRCm39) missense probably damaging 0.98
thrifty UTSW 5 4,026,209 (GRCm39) missense probably damaging 0.99
wee_one UTSW 5 4,093,925 (GRCm39) missense probably damaging 1.00
FR4449:Akap9 UTSW 5 4,031,214 (GRCm39) unclassified probably benign
PIT1430001:Akap9 UTSW 5 4,079,849 (GRCm39) missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4,096,221 (GRCm39) missense probably benign 0.24
R0088:Akap9 UTSW 5 4,011,946 (GRCm39) missense probably benign 0.22
R0309:Akap9 UTSW 5 4,119,038 (GRCm39) missense probably benign 0.01
R0387:Akap9 UTSW 5 4,001,678 (GRCm39) splice site probably benign
R0440:Akap9 UTSW 5 4,114,569 (GRCm39) missense probably damaging 0.99
R0441:Akap9 UTSW 5 4,011,714 (GRCm39) missense probably benign 0.15
R0491:Akap9 UTSW 5 4,022,851 (GRCm39) unclassified probably benign
R0501:Akap9 UTSW 5 4,020,685 (GRCm39) missense probably damaging 1.00
R0507:Akap9 UTSW 5 4,119,043 (GRCm39) missense probably benign 0.41
R0544:Akap9 UTSW 5 4,119,185 (GRCm39) missense probably benign 0.22
R0581:Akap9 UTSW 5 4,100,620 (GRCm39) missense probably benign 0.03
R0611:Akap9 UTSW 5 4,004,870 (GRCm39) missense probably benign 0.00
R0620:Akap9 UTSW 5 4,114,136 (GRCm39) missense probably damaging 0.98
R0639:Akap9 UTSW 5 4,110,318 (GRCm39) missense probably damaging 1.00
R0932:Akap9 UTSW 5 4,096,492 (GRCm39) missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4,114,742 (GRCm39) splice site probably null
R1101:Akap9 UTSW 5 4,096,205 (GRCm39) missense probably benign 0.00
R1159:Akap9 UTSW 5 4,010,865 (GRCm39) missense probably damaging 0.98
R1170:Akap9 UTSW 5 4,105,671 (GRCm39) missense probably benign
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1453:Akap9 UTSW 5 4,025,614 (GRCm39) splice site probably null
R1551:Akap9 UTSW 5 4,119,174 (GRCm39) missense probably benign 0.02
R1608:Akap9 UTSW 5 4,011,783 (GRCm39) missense probably damaging 1.00
R1652:Akap9 UTSW 5 4,127,210 (GRCm39) missense probably damaging 1.00
R1659:Akap9 UTSW 5 4,114,633 (GRCm39) missense probably damaging 1.00
R1713:Akap9 UTSW 5 4,089,345 (GRCm39) critical splice donor site probably null
R1719:Akap9 UTSW 5 4,007,645 (GRCm39) nonsense probably null
R1720:Akap9 UTSW 5 4,022,791 (GRCm39) missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4,051,667 (GRCm39) missense probably benign 0.41
R1872:Akap9 UTSW 5 4,051,406 (GRCm39) missense probably damaging 1.00
R1876:Akap9 UTSW 5 4,011,809 (GRCm39) missense probably benign 0.28
R1881:Akap9 UTSW 5 4,100,173 (GRCm39) missense probably benign
R1950:Akap9 UTSW 5 4,010,677 (GRCm39) missense probably damaging 1.00
R1980:Akap9 UTSW 5 4,022,771 (GRCm39) missense probably damaging 0.99
R1993:Akap9 UTSW 5 4,088,520 (GRCm39) splice site probably null
R2008:Akap9 UTSW 5 4,010,131 (GRCm39) missense possibly damaging 0.47
R2020:Akap9 UTSW 5 4,011,967 (GRCm39) missense probably damaging 1.00
R2051:Akap9 UTSW 5 4,025,685 (GRCm39) nonsense probably null
R2061:Akap9 UTSW 5 4,011,010 (GRCm39) missense probably damaging 1.00
R2109:Akap9 UTSW 5 4,094,847 (GRCm39) missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4,114,509 (GRCm39) missense probably damaging 1.00
R2225:Akap9 UTSW 5 4,127,271 (GRCm39) missense probably damaging 0.96
R2232:Akap9 UTSW 5 4,096,603 (GRCm39) missense probably damaging 1.00
R2424:Akap9 UTSW 5 4,115,279 (GRCm39) missense probably damaging 0.97
R2483:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R2879:Akap9 UTSW 5 4,026,353 (GRCm39) intron probably benign
R3622:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3623:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3624:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4,120,351 (GRCm39) missense probably damaging 1.00
R3806:Akap9 UTSW 5 4,004,410 (GRCm39) missense probably benign 0.00
R4023:Akap9 UTSW 5 4,042,077 (GRCm39) missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4,093,996 (GRCm39) missense probably damaging 0.99
R4434:Akap9 UTSW 5 4,082,708 (GRCm39) missense probably damaging 0.99
R4529:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4530:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4532:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4533:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4585:Akap9 UTSW 5 4,026,151 (GRCm39) missense probably benign 0.00
R4586:Akap9 UTSW 5 4,026,151 (GRCm39) missense probably benign 0.00
R4655:Akap9 UTSW 5 4,096,403 (GRCm39) missense probably benign 0.14
R4676:Akap9 UTSW 5 4,114,515 (GRCm39) nonsense probably null
R4676:Akap9 UTSW 5 4,082,774 (GRCm39) missense probably damaging 1.00
R4724:Akap9 UTSW 5 4,105,339 (GRCm39) missense probably benign
R4731:Akap9 UTSW 5 4,012,266 (GRCm39) missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4,063,901 (GRCm39) missense probably damaging 0.98
R4733:Akap9 UTSW 5 4,063,901 (GRCm39) missense probably damaging 0.98
R4743:Akap9 UTSW 5 4,011,013 (GRCm39) missense probably damaging 1.00
R4749:Akap9 UTSW 5 4,018,737 (GRCm39) missense probably benign 0.41
R4756:Akap9 UTSW 5 4,051,418 (GRCm39) missense probably damaging 0.99
R4757:Akap9 UTSW 5 4,058,382 (GRCm39) missense probably damaging 1.00
R4860:Akap9 UTSW 5 4,084,916 (GRCm39) intron probably benign
R4937:Akap9 UTSW 5 4,100,145 (GRCm39) splice site probably null
R4960:Akap9 UTSW 5 4,007,664 (GRCm39) missense probably benign 0.15
R4974:Akap9 UTSW 5 4,011,466 (GRCm39) missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4,051,748 (GRCm39) missense probably damaging 0.96
R5160:Akap9 UTSW 5 4,080,007 (GRCm39) missense probably damaging 1.00
R5200:Akap9 UTSW 5 4,010,734 (GRCm39) missense probably benign 0.00
R5245:Akap9 UTSW 5 4,026,209 (GRCm39) missense probably damaging 0.99
R5293:Akap9 UTSW 5 3,998,687 (GRCm39) missense probably damaging 0.99
R5408:Akap9 UTSW 5 4,108,458 (GRCm39) missense possibly damaging 0.84
R5507:Akap9 UTSW 5 4,018,683 (GRCm39) missense probably benign 0.41
R5517:Akap9 UTSW 5 4,051,665 (GRCm39) missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4,114,714 (GRCm39) missense possibly damaging 0.93
R5619:Akap9 UTSW 5 4,004,760 (GRCm39) intron probably benign
R5645:Akap9 UTSW 5 4,100,590 (GRCm39) missense probably benign 0.09
R5669:Akap9 UTSW 5 4,100,540 (GRCm39) nonsense probably null
R5686:Akap9 UTSW 5 4,021,926 (GRCm39) missense probably benign 0.00
R5697:Akap9 UTSW 5 4,010,170 (GRCm39) missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4,096,064 (GRCm39) missense probably benign 0.13
R5875:Akap9 UTSW 5 4,127,285 (GRCm39) missense probably benign 0.01
R5897:Akap9 UTSW 5 4,127,904 (GRCm39) missense probably benign 0.23
R5999:Akap9 UTSW 5 4,093,925 (GRCm39) missense probably damaging 1.00
R6025:Akap9 UTSW 5 4,082,801 (GRCm39) missense probably damaging 1.00
R6078:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
R6138:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
R6225:Akap9 UTSW 5 4,012,105 (GRCm39) missense probably damaging 1.00
R6243:Akap9 UTSW 5 4,115,000 (GRCm39) splice site probably null
R6326:Akap9 UTSW 5 4,012,061 (GRCm39) missense probably damaging 1.00
R6564:Akap9 UTSW 5 4,078,491 (GRCm39) missense probably damaging 0.98
R6617:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R6625:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R6632:Akap9 UTSW 5 4,063,842 (GRCm39) splice site probably null
R6677:Akap9 UTSW 5 4,079,869 (GRCm39) missense probably benign 0.21
R6717:Akap9 UTSW 5 4,114,086 (GRCm39) missense probably damaging 1.00
R6893:Akap9 UTSW 5 4,011,709 (GRCm39) missense probably benign 0.32
R6915:Akap9 UTSW 5 4,010,551 (GRCm39) missense probably benign 0.03
R6938:Akap9 UTSW 5 4,096,628 (GRCm39) missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4,096,699 (GRCm39) missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4,096,699 (GRCm39) missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4,115,866 (GRCm39) missense possibly damaging 0.65
R7032:Akap9 UTSW 5 4,004,896 (GRCm39) missense probably benign
R7164:Akap9 UTSW 5 4,110,364 (GRCm39) missense probably damaging 0.96
R7170:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7192:Akap9 UTSW 5 4,055,723 (GRCm39) splice site probably null
R7284:Akap9 UTSW 5 4,006,246 (GRCm39) missense probably damaging 1.00
R7299:Akap9 UTSW 5 4,082,696 (GRCm39) missense probably damaging 1.00
R7313:Akap9 UTSW 5 4,054,933 (GRCm39) missense probably damaging 1.00
R7326:Akap9 UTSW 5 4,095,930 (GRCm39) missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4,096,364 (GRCm39) missense probably damaging 0.99
R7455:Akap9 UTSW 5 4,022,792 (GRCm39) missense probably benign 0.03
R7482:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7489:Akap9 UTSW 5 4,054,933 (GRCm39) missense probably damaging 1.00
R7525:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7528:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7576:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7577:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7578:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7610:Akap9 UTSW 5 4,007,677 (GRCm39) missense possibly damaging 0.95
R7658:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7754:Akap9 UTSW 5 4,096,736 (GRCm39) missense probably benign 0.03
R7818:Akap9 UTSW 5 4,063,875 (GRCm39) nonsense probably null
R7979:Akap9 UTSW 5 4,100,381 (GRCm39) missense probably benign
R7991:Akap9 UTSW 5 4,114,949 (GRCm39) splice site probably null
R8036:Akap9 UTSW 5 4,120,397 (GRCm39) nonsense probably null
R8054:Akap9 UTSW 5 4,088,707 (GRCm39) critical splice donor site probably null
R8116:Akap9 UTSW 5 4,111,183 (GRCm39) missense probably benign 0.04
R8150:Akap9 UTSW 5 4,011,982 (GRCm39) missense probably damaging 1.00
R8234:Akap9 UTSW 5 4,094,845 (GRCm39) missense probably benign 0.18
R8348:Akap9 UTSW 5 3,998,897 (GRCm39) critical splice donor site probably null
R8365:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R8366:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R8448:Akap9 UTSW 5 3,998,897 (GRCm39) critical splice donor site probably null
R8466:Akap9 UTSW 5 4,088,659 (GRCm39) missense probably damaging 1.00
R8772:Akap9 UTSW 5 4,096,255 (GRCm39) missense probably damaging 1.00
R8881:Akap9 UTSW 5 4,011,279 (GRCm39) missense
R8937:Akap9 UTSW 5 4,094,048 (GRCm39) missense possibly damaging 0.78
R8956:Akap9 UTSW 5 3,998,805 (GRCm39) missense possibly damaging 0.79
R9000:Akap9 UTSW 5 4,105,650 (GRCm39) missense probably benign
R9049:Akap9 UTSW 5 4,114,597 (GRCm39) missense
R9074:Akap9 UTSW 5 4,127,959 (GRCm39) missense probably benign 0.40
R9124:Akap9 UTSW 5 4,111,284 (GRCm39) missense probably damaging 0.99
R9129:Akap9 UTSW 5 4,119,089 (GRCm39) missense probably benign 0.00
R9371:Akap9 UTSW 5 4,011,852 (GRCm39) missense possibly damaging 0.83
R9424:Akap9 UTSW 5 4,012,224 (GRCm39) nonsense probably null
R9424:Akap9 UTSW 5 4,012,223 (GRCm39) nonsense probably null
R9509:Akap9 UTSW 5 4,096,349 (GRCm39) missense probably benign
R9515:Akap9 UTSW 5 4,105,709 (GRCm39) missense probably damaging 1.00
R9567:Akap9 UTSW 5 4,127,311 (GRCm39) missense possibly damaging 0.89
R9587:Akap9 UTSW 5 4,119,149 (GRCm39) missense probably damaging 1.00
R9619:Akap9 UTSW 5 4,094,833 (GRCm39) missense probably damaging 1.00
R9635:Akap9 UTSW 5 4,100,545 (GRCm39) missense probably benign 0.20
R9680:Akap9 UTSW 5 4,011,587 (GRCm39) missense probably benign 0.03
R9691:Akap9 UTSW 5 4,010,491 (GRCm39) missense probably damaging 1.00
R9726:Akap9 UTSW 5 4,053,757 (GRCm39) missense probably benign 0.39
U15987:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
X0026:Akap9 UTSW 5 4,064,039 (GRCm39) missense probably damaging 1.00
X0057:Akap9 UTSW 5 4,025,598 (GRCm39) critical splice acceptor site probably null
Z1176:Akap9 UTSW 5 4,012,251 (GRCm39) missense probably damaging 0.96
Z1177:Akap9 UTSW 5 4,096,189 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATGTACAGTCCTTCGGAACAAG -3'
(R):5'- TTTCCAGCGTCTCAGATGGG -3'

Sequencing Primer
(F):5'- GAGAGATCCATTGCCGTAGATCC -3'
(R):5'- CCAGCGTCTCAGATGGGAAAATTC -3'
Posted On 2015-04-17