Incidental Mutation 'R3919:Rnf103'
ID 306887
Institutional Source Beutler Lab
Gene Symbol Rnf103
Ensembl Gene ENSMUSG00000052656
Gene Name ring finger protein 103
Synonyms Zfp103, kf-1
MMRRC Submission 040817-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.215) question?
Stock # R3919 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 71470878-71487865 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 71487331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 654 (R654Q)
Ref Sequence ENSEMBL: ENSMUSP00000109817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064637] [ENSMUST00000114178] [ENSMUST00000114179]
AlphaFold Q9R1W3
Predicted Effect probably benign
Transcript: ENSMUST00000064637
AA Change: R654Q

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000066324
Gene: ENSMUSG00000052656
AA Change: R654Q

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114178
SMART Domains Protein: ENSMUSP00000109816
Gene: ENSMUSG00000052656

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114179
AA Change: R654Q

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109817
Gene: ENSMUSG00000052656
AA Change: R654Q

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150069
Meta Mutation Damage Score 0.0895 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a member of the RING finger family of E3 ubiquitin-protein ligases. These proteins catalyze the transfer of the ubiquitin protein from a ubiquitin E2 enzyme to a protein substrate. Homozygous knockout mice for this gene exhibit enhanced anxiety-like behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display significantly increased anxiety-like behavior under stressful conditions as well as increased prepulse inhibition and a reduced startle amplitude with no detectable changes in exploratory locomotion or behavioral despair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 43,879,852 (GRCm39) probably benign Het
4930567H17Rik C T X: 69,438,135 (GRCm39) A53T probably benign Het
Abcb5 A G 12: 118,854,353 (GRCm39) M854T possibly damaging Het
Akap9 T A 5: 4,011,764 (GRCm39) Y822* probably null Het
Apoe T C 7: 19,430,472 (GRCm39) T257A probably benign Het
Atm C A 9: 53,403,578 (GRCm39) A1365S probably benign Het
Bmp2k T C 5: 97,222,599 (GRCm39) S674P unknown Het
Cd177 T C 7: 24,443,858 (GRCm39) S747G probably benign Het
Cdk5rap2 A G 4: 70,298,460 (GRCm39) F91L possibly damaging Het
Chil4 A T 3: 106,109,848 (GRCm39) N388K probably benign Het
Dnah3 G A 7: 119,550,303 (GRCm39) L3328F probably damaging Het
Dysf G A 6: 84,163,491 (GRCm39) probably null Het
Ercc5 C A 1: 44,201,091 (GRCm39) T217K probably damaging Het
Esyt1 T A 10: 128,356,905 (GRCm39) probably benign Het
Ifih1 C A 2: 62,453,845 (GRCm39) probably benign Het
Ints12 A T 3: 132,806,444 (GRCm39) T124S probably benign Het
Kdm5d T C Y: 939,914 (GRCm39) L1022P probably damaging Het
Lama2 T A 10: 26,994,501 (GRCm39) N1803Y probably damaging Het
Lpcat2 C T 8: 93,640,902 (GRCm39) T449I probably damaging Het
Ly6c2 A T 15: 74,980,613 (GRCm39) probably null Het
Mast3 T C 8: 71,232,066 (GRCm39) K1304E probably benign Het
Mdm4 T C 1: 132,922,306 (GRCm39) K279E possibly damaging Het
Mest G A 6: 30,742,749 (GRCm39) S132N probably benign Het
Mras T A 9: 99,293,473 (GRCm39) I56F probably damaging Het
Mrgprb1 T C 7: 48,097,829 (GRCm39) K28E probably benign Het
Myrip G A 9: 120,261,695 (GRCm39) G436D probably damaging Het
Nr2e3 T A 9: 59,850,723 (GRCm39) T379S probably damaging Het
Or8k27 A G 2: 86,275,762 (GRCm39) V188A probably benign Het
Plscr3 T A 11: 69,738,236 (GRCm39) probably benign Het
Pola1 C A X: 92,505,078 (GRCm39) R1313L probably benign Het
Ppt2 T C 17: 34,841,897 (GRCm39) N213S probably damaging Het
Prelid2 T A 18: 42,070,740 (GRCm39) D31V possibly damaging Het
Psmb9 C T 17: 34,402,588 (GRCm39) probably null Het
Rec8 A G 14: 55,858,716 (GRCm39) T164A probably benign Het
Setdb2 T A 14: 59,656,616 (GRCm39) I250F probably damaging Het
Slurp1 A T 15: 74,598,659 (GRCm39) *111K probably null Het
Sphkap T G 1: 83,254,179 (GRCm39) E903A probably damaging Het
Sst T C 16: 23,708,591 (GRCm39) D80G possibly damaging Het
Stat4 C T 1: 52,135,981 (GRCm39) T430I possibly damaging Het
Tmprss4 C T 9: 45,091,964 (GRCm39) V174M probably benign Het
Trim6 A T 7: 103,882,057 (GRCm39) Y436F probably damaging Het
Ttc28 C A 5: 111,433,245 (GRCm39) A2093E possibly damaging Het
Vav3 A G 3: 109,434,854 (GRCm39) N462D possibly damaging Het
Whrn G T 4: 63,413,421 (GRCm39) S17* probably null Het
Zfhx4 T A 3: 5,464,175 (GRCm39) S1469R possibly damaging Het
Zfp108 T A 7: 23,960,257 (GRCm39) C283S probably damaging Het
Other mutations in Rnf103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rnf103 APN 6 71,486,733 (GRCm39) missense probably damaging 0.99
IGL00589:Rnf103 APN 6 71,486,067 (GRCm39) missense probably benign 0.00
IGL01601:Rnf103 APN 6 71,486,167 (GRCm39) missense probably damaging 1.00
IGL01732:Rnf103 APN 6 71,487,366 (GRCm39) missense probably damaging 0.97
IGL02130:Rnf103 APN 6 71,486,548 (GRCm39) missense probably damaging 1.00
IGL02227:Rnf103 APN 6 71,487,172 (GRCm39) missense probably benign 0.01
IGL02386:Rnf103 APN 6 71,486,202 (GRCm39) missense probably benign
IGL02532:Rnf103 APN 6 71,486,636 (GRCm39) missense probably damaging 0.96
IGL02532:Rnf103 APN 6 71,486,809 (GRCm39) missense probably benign 0.19
IGL02747:Rnf103 APN 6 71,486,161 (GRCm39) missense probably damaging 0.97
IGL02839:Rnf103 APN 6 71,486,689 (GRCm39) missense probably benign 0.41
IGL03247:Rnf103 APN 6 71,487,289 (GRCm39) missense possibly damaging 0.78
R0140:Rnf103 UTSW 6 71,486,315 (GRCm39) missense possibly damaging 0.76
R0308:Rnf103 UTSW 6 71,486,686 (GRCm39) missense probably damaging 1.00
R0764:Rnf103 UTSW 6 71,486,566 (GRCm39) missense probably damaging 0.96
R1428:Rnf103 UTSW 6 71,485,983 (GRCm39) missense probably damaging 1.00
R2362:Rnf103 UTSW 6 71,487,001 (GRCm39) missense probably benign 0.08
R3847:Rnf103 UTSW 6 71,485,859 (GRCm39) missense probably damaging 1.00
R3849:Rnf103 UTSW 6 71,485,859 (GRCm39) missense probably damaging 1.00
R4914:Rnf103 UTSW 6 71,487,248 (GRCm39) missense possibly damaging 0.71
R5620:Rnf103 UTSW 6 71,486,992 (GRCm39) missense probably benign 0.04
R5634:Rnf103 UTSW 6 71,486,601 (GRCm39) missense probably benign 0.01
R5682:Rnf103 UTSW 6 71,485,708 (GRCm39) intron probably benign
R5791:Rnf103 UTSW 6 71,485,909 (GRCm39) missense probably damaging 0.99
R5994:Rnf103 UTSW 6 71,473,894 (GRCm39) missense probably damaging 0.99
R6347:Rnf103 UTSW 6 71,482,808 (GRCm39) missense possibly damaging 0.89
R6551:Rnf103 UTSW 6 71,487,349 (GRCm39) missense probably damaging 1.00
R7739:Rnf103 UTSW 6 71,486,463 (GRCm39) missense possibly damaging 0.77
R7819:Rnf103 UTSW 6 71,485,914 (GRCm39) missense probably benign 0.00
R7903:Rnf103 UTSW 6 71,486,138 (GRCm39) missense probably damaging 1.00
R8750:Rnf103 UTSW 6 71,486,602 (GRCm39) missense probably benign 0.11
R8784:Rnf103 UTSW 6 71,486,982 (GRCm39) missense probably benign 0.03
R8974:Rnf103 UTSW 6 71,486,092 (GRCm39) missense probably damaging 0.98
R9154:Rnf103 UTSW 6 71,487,099 (GRCm39) missense probably benign 0.06
R9505:Rnf103 UTSW 6 71,487,049 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATGTGAGAGCAGCCCATG -3'
(R):5'- TCCTGTCACTGCACTAACATTAAAC -3'

Sequencing Primer
(F):5'- GAGGTCGTATGGATCACATAATACTG -3'
(R):5'- GTCACTGCACTAACATTAAACTAAAC -3'
Posted On 2015-04-17