Incidental Mutation 'R0375:Ppp6r1'
ID30689
Institutional Source Beutler Lab
Gene Symbol Ppp6r1
Ensembl Gene ENSMUSG00000052296
Gene Nameprotein phosphatase 6, regulatory subunit 1
SynonymsB430201G11Rik, Saps1, 2010309P17Rik, Pp6r1
MMRRC Submission 038581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R0375 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4631495-4659019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4633287 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 768 (V768A)
Ref Sequence ENSEMBL: ENSMUSP00000066736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055085] [ENSMUST00000064099] [ENSMUST00000205360] [ENSMUST00000205402] [ENSMUST00000206610]
Predicted Effect probably benign
Transcript: ENSMUST00000055085
SMART Domains Protein: ENSMUSP00000060237
Gene: ENSMUSG00000045282

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:YhhN 47 217 1.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064099
AA Change: V768A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066736
Gene: ENSMUSG00000052296
AA Change: V768A

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:SAPS 128 378 4.6e-69 PFAM
Pfam:SAPS 372 519 1.8e-39 PFAM
low complexity region 525 536 N/A INTRINSIC
low complexity region 618 639 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 842 855 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205360
Predicted Effect probably benign
Transcript: ENSMUST00000205402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206485
Predicted Effect probably benign
Transcript: ENSMUST00000206610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206768
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS1, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS1 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,046,252 T4707I probably damaging Het
5730522E02Rik T A 11: 25,769,092 Y17F unknown Het
Aars2 A G 17: 45,514,550 D313G probably damaging Het
Abca9 A T 11: 110,115,447 D1277E probably benign Het
Adgrl1 G T 8: 83,934,901 A981S probably damaging Het
Aff3 T G 1: 38,204,940 K917Q possibly damaging Het
BC049715 A T 6: 136,839,996 H78L probably benign Het
Cacna1g C A 11: 94,411,054 A2027S possibly damaging Het
Camk1g G A 1: 193,356,401 probably benign Het
Carf T C 1: 60,144,002 V386A probably damaging Het
Cd46 A G 1: 195,086,164 S82P probably benign Het
Clic5 A G 17: 44,270,623 E180G possibly damaging Het
Col27a1 A G 4: 63,225,661 T529A probably benign Het
Col7a1 C T 9: 108,980,237 R2627C unknown Het
Cuzd1 G A 7: 131,311,908 probably benign Het
Cwc27 T C 13: 104,807,823 D50G possibly damaging Het
Dhx38 A G 8: 109,555,181 V735A possibly damaging Het
Dhx57 T G 17: 80,258,121 E834A probably damaging Het
Dsg4 A G 18: 20,470,879 D801G probably damaging Het
Dtx1 T C 5: 120,681,399 E578G probably damaging Het
F830016B08Rik A T 18: 60,300,193 H116L probably damaging Het
Fam208b A G 13: 3,596,842 V61A possibly damaging Het
Fbxw18 T C 9: 109,688,839 I360V possibly damaging Het
Fignl2 G A 15: 101,054,093 P103S probably benign Het
Frmpd1 A G 4: 45,284,196 T1006A probably benign Het
Ggnbp2 G T 11: 84,836,374 C545* probably null Het
Gm3336 A G 8: 70,718,645 probably benign Het
Gpr37 T C 6: 25,669,291 N518S probably benign Het
Hbs1l T A 10: 21,342,541 D312E possibly damaging Het
Hoxd10 C A 2: 74,692,720 S247R probably benign Het
Ifnb1 A T 4: 88,522,744 F11I probably benign Het
Marf1 T C 16: 14,151,320 probably benign Het
Myo1f T A 17: 33,601,956 V879E probably benign Het
Naip1 A G 13: 100,409,148 F1291L probably benign Het
Nckap1l A G 15: 103,474,159 E529G probably damaging Het
Npm3 T C 19: 45,748,229 E157G probably damaging Het
Olfr1200 T A 2: 88,767,641 T225S possibly damaging Het
Olfr1240 G T 2: 89,439,396 N294K probably benign Het
Olfr248 A G 1: 174,391,209 T47A probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Prrc1 A G 18: 57,362,492 T14A probably damaging Het
Ranbp2 T C 10: 58,477,283 L1275P probably damaging Het
Rnf214 C A 9: 45,899,823 V181F probably damaging Het
Ror2 T C 13: 53,132,004 N58S probably damaging Het
Selplg G A 5: 113,820,008 T79I probably damaging Het
Setd1b G A 5: 123,157,437 G1023S unknown Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Skint5 A G 4: 113,705,596 V803A unknown Het
Slc25a46 T C 18: 31,583,266 I394M possibly damaging Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Spag17 C A 3: 100,027,590 T704K probably benign Het
Tas2r144 T A 6: 42,216,124 M266K possibly damaging Het
Tbc1d31 T A 15: 57,955,350 L783H probably benign Het
Tbck C A 3: 132,751,232 probably benign Het
Vcan A G 13: 89,691,275 V2050A probably damaging Het
Vmn1r70 T A 7: 10,634,060 N158K probably damaging Het
Vmn2r103 T A 17: 19,792,859 Y81N probably benign Het
Vmn2r103 A G 17: 19,793,464 T173A probably benign Het
Ylpm1 T G 12: 85,014,980 S552A unknown Het
Zdhhc17 A T 10: 110,982,106 Y58* probably null Het
Other mutations in Ppp6r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Ppp6r1 APN 7 4639987 splice site probably null
IGL02232:Ppp6r1 APN 7 4633342 missense probably damaging 0.98
IGL02674:Ppp6r1 APN 7 4646813 missense probably damaging 1.00
IGL02887:Ppp6r1 APN 7 4642212 missense probably damaging 1.00
IGL02990:Ppp6r1 APN 7 4643023 missense possibly damaging 0.83
IGL03135:Ppp6r1 APN 7 4642160 missense possibly damaging 0.90
IGL03399:Ppp6r1 APN 7 4643252 missense probably damaging 1.00
R0412:Ppp6r1 UTSW 7 4642214 missense probably damaging 0.98
R0760:Ppp6r1 UTSW 7 4639723 missense probably benign 0.00
R0883:Ppp6r1 UTSW 7 4639710 missense possibly damaging 0.89
R1478:Ppp6r1 UTSW 7 4640378 splice site probably null
R1515:Ppp6r1 UTSW 7 4643258 missense probably damaging 0.97
R1768:Ppp6r1 UTSW 7 4633692 critical splice donor site probably null
R1772:Ppp6r1 UTSW 7 4642031 missense probably benign 0.00
R4017:Ppp6r1 UTSW 7 4633744 missense probably benign 0.07
R4519:Ppp6r1 UTSW 7 4641046 unclassified probably null
R4795:Ppp6r1 UTSW 7 4641054 missense possibly damaging 0.66
R4849:Ppp6r1 UTSW 7 4643207 missense probably damaging 1.00
R5214:Ppp6r1 UTSW 7 4643177 missense probably benign 0.00
R5416:Ppp6r1 UTSW 7 4639748 missense possibly damaging 0.96
R5643:Ppp6r1 UTSW 7 4633772 missense probably benign 0.30
R5765:Ppp6r1 UTSW 7 4642208 missense possibly damaging 0.67
R6126:Ppp6r1 UTSW 7 4643377 missense possibly damaging 0.48
R6854:Ppp6r1 UTSW 7 4632396 missense probably benign 0.02
R6932:Ppp6r1 UTSW 7 4633292 missense possibly damaging 0.84
R7011:Ppp6r1 UTSW 7 4646826 missense probably damaging 1.00
R7486:Ppp6r1 UTSW 7 4639900 missense probably benign 0.17
R7500:Ppp6r1 UTSW 7 4636130 missense probably benign 0.04
X0062:Ppp6r1 UTSW 7 4640307 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAATGGTCACCTGTCCAAGGAGC -3'
(R):5'- ACTGCTACCTTTGACACAGTGCC -3'

Sequencing Primer
(F):5'- ATCCCATGCAGTGTGGC -3'
(R):5'- TGACACAGTGCCTATGGATGC -3'
Posted On2013-04-24