Incidental Mutation 'R3919:Apoe'
ID306890
Institutional Source Beutler Lab
Gene Symbol Apoe
Ensembl Gene ENSMUSG00000002985
Gene Nameapolipoprotein E
Synonyms
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R3919 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19696109-19699188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19696547 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 257 (T257A)
Ref Sequence ENSEMBL: ENSMUSP00000134160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003066] [ENSMUST00000032555] [ENSMUST00000045035] [ENSMUST00000093552] [ENSMUST00000108451] [ENSMUST00000172808] [ENSMUST00000172983] [ENSMUST00000173739] [ENSMUST00000174064] [ENSMUST00000174144] [ENSMUST00000174191] [ENSMUST00000174355] [ENSMUST00000174710] [ENSMUST00000207978]
Predicted Effect probably benign
Transcript: ENSMUST00000003066
AA Change: T257A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003066
Gene: ENSMUSG00000002985
AA Change: T257A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032555
SMART Domains Protein: ENSMUSP00000032555
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 7.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045035
SMART Domains Protein: ENSMUSP00000045571
Gene: ENSMUSG00000040564

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ApoC-I 27 87 1.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093552
SMART Domains Protein: ENSMUSP00000104090
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108451
SMART Domains Protein: ENSMUSP00000104091
Gene: ENSMUSG00000040564

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ApoC-I 27 87 3.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167646
SMART Domains Protein: ENSMUSP00000132032
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 201 1.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172808
SMART Domains Protein: ENSMUSP00000134558
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Apolipoprotein 61 146 8.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172983
SMART Domains Protein: ENSMUSP00000133359
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173739
AA Change: T257A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133371
Gene: ENSMUSG00000002985
AA Change: T257A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174064
AA Change: T257A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133302
Gene: ENSMUSG00000002985
AA Change: T257A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 73 284 2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174144
SMART Domains Protein: ENSMUSP00000134622
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174191
SMART Domains Protein: ENSMUSP00000133447
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174355
AA Change: T257A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134160
Gene: ENSMUSG00000002985
AA Change: T257A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174710
SMART Domains Protein: ENSMUSP00000134429
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207525
Predicted Effect probably benign
Transcript: ENSMUST00000207978
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mutations at this locus cause diet-induced hypercholesterolemia and atherosclerosis. Homozygous null mutants also develop foam-cell rich deposits in proximal aorta, impaired blood-nerve and blood-brain barriers, and many xanthomatous lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Apoe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Apoe APN 7 19696600 missense probably damaging 1.00
IGL03324:Apoe APN 7 19696537 missense probably benign 0.05
R0008:Apoe UTSW 7 19697080 missense probably damaging 0.99
R2860:Apoe UTSW 7 19697554 missense probably damaging 1.00
R2861:Apoe UTSW 7 19697554 missense probably damaging 1.00
R2862:Apoe UTSW 7 19697554 missense probably damaging 1.00
R4583:Apoe UTSW 7 19697498 missense possibly damaging 0.66
R4756:Apoe UTSW 7 19696921 missense probably benign 0.20
R5027:Apoe UTSW 7 19697015 missense probably damaging 1.00
R6188:Apoe UTSW 7 19698380 intron probably benign
R6464:Apoe UTSW 7 19697536 missense probably damaging 1.00
R7652:Apoe UTSW 7 19696610 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATTGATTCTCCTGGGCCAC -3'
(R):5'- TAGCTGTGTACAAGGCAGGG -3'

Sequencing Primer
(F):5'- GCCACTGGGGTGATGATG -3'
(R):5'- TGTGAGTGCCATCCGTGAGC -3'
Posted On2015-04-17