Incidental Mutation 'R3919:Trim6'
ID 306895
Institutional Source Beutler Lab
Gene Symbol Trim6
Ensembl Gene ENSMUSG00000072244
Gene Name tripartite motif-containing 6
Synonyms C430046K18Rik, D7Ertd684e
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R3919 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 104218793-104235152 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104232850 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 436 (Y436F)
Ref Sequence ENSEMBL: ENSMUSP00000149805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098180] [ENSMUST00000214578]
AlphaFold Q8BGE7
Predicted Effect probably damaging
Transcript: ENSMUST00000097023
AA Change: Y436F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094787
Gene: ENSMUSG00000072244
AA Change: Y436F

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
PDB:2YRG|A 83 105 2e-8 PDB
coiled coil region 107 194 N/A INTRINSIC
PRY 274 325 5.31e-9 SMART
Pfam:SPRY 328 456 2.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098180
AA Change: Y462F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095782
Gene: ENSMUSG00000072244
AA Change: Y462F

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
BBOX 92 133 8.87e-11 SMART
low complexity region 194 211 N/A INTRINSIC
PRY 300 351 5.31e-9 SMART
Pfam:SPRY 354 482 9.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214578
AA Change: Y436F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1864 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. The protein localizes to the nucleus, but its specific function has not been identified. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from this gene into the downstream TRIM34 gene has also been observed, which results in a fusion product from these neighboring family members. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Trim6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Trim6 APN 7 104230743 missense probably benign 0.00
IGL02493:Trim6 APN 7 104232640 missense probably benign 0.04
IGL02517:Trim6 APN 7 104232357 splice site probably benign
R0026:Trim6 UTSW 7 104225809 splice site probably null
R1505:Trim6 UTSW 7 104232564 missense probably damaging 1.00
R1711:Trim6 UTSW 7 104232837 missense probably damaging 1.00
R2507:Trim6 UTSW 7 104228185 missense probably damaging 1.00
R4731:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4732:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4733:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4858:Trim6 UTSW 7 104232485 nonsense probably null
R5120:Trim6 UTSW 7 104228240 missense probably damaging 1.00
R7147:Trim6 UTSW 7 104225570 missense probably benign 0.00
R7372:Trim6 UTSW 7 104232636 missense probably benign 0.04
R7407:Trim6 UTSW 7 104225901 missense probably damaging 1.00
R7526:Trim6 UTSW 7 104232832 missense probably damaging 1.00
R7657:Trim6 UTSW 7 104231861 missense possibly damaging 0.79
R8444:Trim6 UTSW 7 104232672 missense probably damaging 1.00
R8783:Trim6 UTSW 7 104225646 missense probably damaging 1.00
R8925:Trim6 UTSW 7 104232448 missense probably benign 0.00
R8927:Trim6 UTSW 7 104232448 missense probably benign 0.00
R9031:Trim6 UTSW 7 104225952 missense probably damaging 1.00
R9284:Trim6 UTSW 7 104232909 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCAGGTATCAGCCACAGTG -3'
(R):5'- CCATGAGATGGCTTAAGGGTGC -3'

Sequencing Primer
(F):5'- ATACTGGGTGATTGGCTTGCAG -3'
(R):5'- CGCACTCTTAGCAATGGAAGGTATC -3'
Posted On 2015-04-17