Incidental Mutation 'R3919:Lpcat2'
ID306898
Institutional Source Beutler Lab
Gene Symbol Lpcat2
Ensembl Gene ENSMUSG00000033192
Gene Namelysophosphatidylcholine acyltransferase 2
SynonymslysoPAFAT/LPCAT2, LPCAT2, Aytl1a, Aytl1
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R3919 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location92855339-92919279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92914274 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 449 (T449I)
Ref Sequence ENSEMBL: ENSMUSP00000049252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046290] [ENSMUST00000209265] [ENSMUST00000210099]
Predicted Effect probably damaging
Transcript: ENSMUST00000046290
AA Change: T449I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049252
Gene: ENSMUSG00000033192
AA Change: T449I

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 35 45 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
PlsC 140 251 2.78e-22 SMART
Blast:PlsC 284 326 3e-19 BLAST
EFh 395 423 4.49e-4 SMART
EFh 432 460 6.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151106
Predicted Effect probably benign
Transcript: ENSMUST00000209265
Predicted Effect probably benign
Transcript: ENSMUST00000210099
AA Change: T409I

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysophospholipid acyltransferase family. The encoded enzyme may function in two ways: to catalyze the biosynthesis of platelet-activating factor (1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine) from 1-O-alkyl-sn-glycero-3-phosphocholine, and to catalyze the synthesis of glycerophospholipid precursors from arachidonyl-CoA and lysophosphatidylcholine. The encoded protein may function in membrane biogenesis and production of platelet-activating factor in inflammatory cells. The enzyme may localize to the endoplasmic reticulum and the Golgi. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Lpcat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Lpcat2 APN 8 92909206 missense probably damaging 1.00
IGL00823:Lpcat2 APN 8 92864970 missense possibly damaging 0.90
IGL00911:Lpcat2 APN 8 92890710 missense probably damaging 0.99
IGL01449:Lpcat2 APN 8 92871147 missense possibly damaging 0.69
IGL01951:Lpcat2 APN 8 92918047 missense probably damaging 1.00
IGL02041:Lpcat2 APN 8 92918181 missense probably benign 0.04
IGL02491:Lpcat2 APN 8 92874251 missense probably damaging 1.00
IGL02957:Lpcat2 APN 8 92875584 nonsense probably null
R0960:Lpcat2 UTSW 8 92869710 missense probably benign
R1236:Lpcat2 UTSW 8 92886569 missense probably damaging 1.00
R1422:Lpcat2 UTSW 8 92879417 missense probably damaging 1.00
R1677:Lpcat2 UTSW 8 92864932 missense probably benign 0.08
R2048:Lpcat2 UTSW 8 92869843 missense possibly damaging 0.94
R3712:Lpcat2 UTSW 8 92918170 missense possibly damaging 0.70
R3951:Lpcat2 UTSW 8 92864903 missense probably benign
R4357:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4358:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4359:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4401:Lpcat2 UTSW 8 92873055 missense possibly damaging 0.61
R4584:Lpcat2 UTSW 8 92889371 missense probably damaging 1.00
R5089:Lpcat2 UTSW 8 92879443 missense probably damaging 1.00
R5127:Lpcat2 UTSW 8 92909191 missense possibly damaging 0.65
R5185:Lpcat2 UTSW 8 92869737 missense probably benign 0.04
R6380:Lpcat2 UTSW 8 92886581 missense probably benign
R6974:Lpcat2 UTSW 8 92873079 missense probably damaging 1.00
R7171:Lpcat2 UTSW 8 92909266 missense probably benign 0.00
R7344:Lpcat2 UTSW 8 92875567 missense probably damaging 0.98
R7356:Lpcat2 UTSW 8 92864983 missense probably benign
R7684:Lpcat2 UTSW 8 92909195 missense possibly damaging 0.91
R7834:Lpcat2 UTSW 8 92918101 missense possibly damaging 0.63
R7917:Lpcat2 UTSW 8 92918101 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CACGCCCAAACTGCTGTAAG -3'
(R):5'- ATTACCAAAAGTGAGCCTAGGG -3'

Sequencing Primer
(F):5'- AGGAGTAGCAGATCTATCTCTCTC -3'
(R):5'- TGAGCCTAGGGAAGCCACAC -3'
Posted On2015-04-17