Incidental Mutation 'R3919:Tmprss4'
ID306899
Institutional Source Beutler Lab
Gene Symbol Tmprss4
Ensembl Gene ENSMUSG00000032091
Gene Nametransmembrane protease, serine 4
Synonyms
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3919 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45172726-45204092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45180666 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 174 (V174M)
Ref Sequence ENSEMBL: ENSMUSP00000131890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034599] [ENSMUST00000165263] [ENSMUST00000170069]
Predicted Effect probably benign
Transcript: ENSMUST00000034599
AA Change: V174M

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034599
Gene: ENSMUSG00000032091
AA Change: V174M

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
LDLa 52 92 1.55e-2 SMART
SR 102 192 2.51e-7 SMART
Tryp_SPc 202 427 9.03e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164650
SMART Domains Protein: ENSMUSP00000130853
Gene: ENSMUSG00000091996

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165263
AA Change: V174M

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131890
Gene: ENSMUSG00000032091
AA Change: V174M

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
LDLa 52 92 1.55e-2 SMART
SR 102 192 2.51e-7 SMART
Tryp_SPc 202 335 2.26e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171277
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine protease family. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified as a gene overexpressed in pancreatic carcinoma. The encoded protein is membrane bound with a N-terminal anchor sequence and a glycosylated extracellular region containing the serine protease domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele appear healthy and response normally to a sodium-deficient diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Tmprss4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Tmprss4 APN 9 45179420 missense probably damaging 1.00
R0153:Tmprss4 UTSW 9 45184336 missense probably benign 0.01
R1445:Tmprss4 UTSW 9 45184385 missense possibly damaging 0.59
R2359:Tmprss4 UTSW 9 45185832 missense probably benign
R3918:Tmprss4 UTSW 9 45180666 missense probably benign 0.13
R4655:Tmprss4 UTSW 9 45176404 missense probably benign
R4949:Tmprss4 UTSW 9 45175543 missense possibly damaging 0.92
R4976:Tmprss4 UTSW 9 45173408 missense possibly damaging 0.86
R5177:Tmprss4 UTSW 9 45173962 missense probably benign 0.09
R5918:Tmprss4 UTSW 9 45175116 nonsense probably null
R6922:Tmprss4 UTSW 9 45185922 missense probably benign
R7091:Tmprss4 UTSW 9 45184273 missense probably damaging 0.97
R7488:Tmprss4 UTSW 9 45175555 missense probably benign 0.03
X0058:Tmprss4 UTSW 9 45177833 missense probably damaging 1.00
Z1088:Tmprss4 UTSW 9 45175465 missense probably damaging 0.98
Z1177:Tmprss4 UTSW 9 45176519 missense probably benign 0.44
Z1177:Tmprss4 UTSW 9 45184241 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGAGCCTGAACGTGGAATCC -3'
(R):5'- CCTTGATGTGGGGACTATTCC -3'

Sequencing Primer
(F):5'- GTGGAATCCCAAAACCCTGG -3'
(R):5'- GGGGACTATTCCTGCTATCCAG -3'
Posted On2015-04-17