Incidental Mutation 'R3919:Esyt1'
ID306905
Institutional Source Beutler Lab
Gene Symbol Esyt1
Ensembl Gene ENSMUSG00000025366
Gene Nameextended synaptotagmin-like protein 1
Synonymsvp115, Mbc2, Fam62a
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R3919 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128509965-128525871 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 128521036 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000026427]
Predicted Effect probably benign
Transcript: ENSMUST00000026427
SMART Domains Protein: ENSMUSP00000026427
Gene: ENSMUSG00000025366

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Pfam:SMP_LBD 125 303 4.3e-80 PFAM
C2 320 422 1.27e-17 SMART
C2 469 563 4.62e-11 SMART
C2 635 737 4.05e-25 SMART
C2 786 879 3.05e-11 SMART
low complexity region 909 921 N/A INTRINSIC
C2 975 1080 1.51e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220045
Predicted Effect probably benign
Transcript: ENSMUST00000220429
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Esyt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Esyt1 APN 10 128517635 missense possibly damaging 0.94
IGL00518:Esyt1 APN 10 128521874 missense probably benign 0.00
IGL00534:Esyt1 APN 10 128515684 critical splice donor site probably null
IGL00578:Esyt1 APN 10 128511743 missense probably damaging 1.00
IGL00899:Esyt1 APN 10 128517063 missense probably damaging 1.00
IGL01308:Esyt1 APN 10 128519791 missense possibly damaging 0.62
IGL01373:Esyt1 APN 10 128518941 missense possibly damaging 0.91
IGL01476:Esyt1 APN 10 128511494 missense probably damaging 0.99
IGL01655:Esyt1 APN 10 128522312 missense possibly damaging 0.72
IGL02302:Esyt1 APN 10 128512367 missense probably damaging 1.00
IGL02441:Esyt1 APN 10 128512424 missense possibly damaging 0.89
IGL02550:Esyt1 APN 10 128522093 missense probably damaging 1.00
IGL02653:Esyt1 APN 10 128511008 missense probably benign
IGL02948:Esyt1 APN 10 128519171 missense probably damaging 0.96
IGL02986:Esyt1 APN 10 128516757 missense probably damaging 0.96
IGL03033:Esyt1 APN 10 128516383 missense probably benign 0.00
R0039:Esyt1 UTSW 10 128520962 missense probably damaging 0.99
R0285:Esyt1 UTSW 10 128512218 missense possibly damaging 0.50
R0453:Esyt1 UTSW 10 128512209 missense probably benign 0.00
R1123:Esyt1 UTSW 10 128516558 missense probably benign 0.35
R1496:Esyt1 UTSW 10 128512428 missense possibly damaging 0.63
R1569:Esyt1 UTSW 10 128518994 missense possibly damaging 0.88
R1691:Esyt1 UTSW 10 128525534 missense probably benign 0.01
R1813:Esyt1 UTSW 10 128519618 missense probably benign
R1827:Esyt1 UTSW 10 128516369 missense probably benign 0.01
R2038:Esyt1 UTSW 10 128511951 missense probably benign 0.00
R2039:Esyt1 UTSW 10 128511951 missense probably benign 0.00
R2115:Esyt1 UTSW 10 128522104 missense probably damaging 0.99
R2696:Esyt1 UTSW 10 128517045 missense probably damaging 1.00
R3980:Esyt1 UTSW 10 128511524 missense probably damaging 0.99
R4223:Esyt1 UTSW 10 128520648 missense probably damaging 1.00
R4225:Esyt1 UTSW 10 128520648 missense probably damaging 1.00
R5249:Esyt1 UTSW 10 128516574 missense probably benign 0.00
R5534:Esyt1 UTSW 10 128519460 missense probably benign 0.07
R5704:Esyt1 UTSW 10 128511510 missense probably damaging 1.00
R6252:Esyt1 UTSW 10 128511902 missense probably benign 0.01
R6431:Esyt1 UTSW 10 128516674 critical splice donor site probably null
R7013:Esyt1 UTSW 10 128525651 missense probably damaging 1.00
R7102:Esyt1 UTSW 10 128516236 missense probably damaging 0.98
R7152:Esyt1 UTSW 10 128515760 missense possibly damaging 0.79
R7570:Esyt1 UTSW 10 128518932 missense possibly damaging 0.52
R7732:Esyt1 UTSW 10 128521825 critical splice donor site probably null
R8009:Esyt1 UTSW 10 128511485 missense probably benign 0.01
R8049:Esyt1 UTSW 10 128512086 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCTTGAGAGAAAGCTCAGTC -3'
(R):5'- AGAAAGGGTCTGGACTTCCC -3'

Sequencing Primer
(F):5'- CCTTGAGAGAAAGCTCAGTCTTCTG -3'
(R):5'- CACATCTATAATCCTGGGACGTGG -3'
Posted On2015-04-17