Incidental Mutation 'R3919:Rec8'
ID 306910
Institutional Source Beutler Lab
Gene Symbol Rec8
Ensembl Gene ENSMUSG00000002324
Gene Name REC8 meiotic recombination protein
Synonyms mrec, Rec8L1
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3919 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 55618037-55625395 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55621259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 164 (T164A)
Ref Sequence ENSEMBL: ENSMUSP00000002395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002395] [ENSMUST00000047131] [ENSMUST00000135221] [ENSMUST00000141499] [ENSMUST00000148351]
AlphaFold Q8C5S7
Predicted Effect probably benign
Transcript: ENSMUST00000002395
AA Change: T164A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000002395
Gene: ENSMUSG00000002324
AA Change: T164A

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 117 2.2e-26 PFAM
low complexity region 235 249 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
Pfam:Rad21_Rec8 536 590 9.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141425
Predicted Effect probably benign
Transcript: ENSMUST00000141499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146528
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227922
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kleisin family of SMC (structural maintenance of chromosome) protein partners. The protein localizes to the axial elements of chromosomes during meiosis in both oocytes and spermatocytes. In the mouse, the homologous protein is a key component of the meiotic cohesion complex, which regulates sister chromatid cohesion and recombination between homologous chromosomes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are infertile and exhibit small ovaries and testes. Females show absence of ovarian follicles and abnormal meiosis, while males exhibit abnormal chromosome pairing during meiosis, abnormal synaptonemal complex formation, and arrest of male meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Rec8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Rec8 APN 14 55623515 nonsense probably null
IGL00427:Rec8 APN 14 55618651 missense probably damaging 1.00
IGL02116:Rec8 APN 14 55624879 splice site probably null
R1349:Rec8 UTSW 14 55618974 missense probably damaging 1.00
R1372:Rec8 UTSW 14 55618974 missense probably damaging 1.00
R1564:Rec8 UTSW 14 55622275 splice site probably null
R1667:Rec8 UTSW 14 55618796 missense probably damaging 1.00
R1970:Rec8 UTSW 14 55624142 missense probably damaging 1.00
R3157:Rec8 UTSW 14 55625306 missense probably damaging 0.96
R3625:Rec8 UTSW 14 55622497 missense possibly damaging 0.94
R4280:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4282:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4283:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4622:Rec8 UTSW 14 55624758 missense probably damaging 1.00
R4894:Rec8 UTSW 14 55625330 missense probably damaging 1.00
R5488:Rec8 UTSW 14 55622826 missense probably benign 0.00
R5489:Rec8 UTSW 14 55622826 missense probably benign 0.00
R6113:Rec8 UTSW 14 55622478 missense probably damaging 0.99
R6264:Rec8 UTSW 14 55619179 missense probably damaging 1.00
R6439:Rec8 UTSW 14 55618619 missense possibly damaging 0.50
R7952:Rec8 UTSW 14 55625303 missense possibly damaging 0.93
Z1088:Rec8 UTSW 14 55625147 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGGGAGGAGAGCTGTCAA -3'
(R):5'- CTAGGAGATGGGGTTACAGGTG -3'

Sequencing Primer
(F):5'- AGCTCTGGGGATCCAACATCTATTG -3'
(R):5'- TTCTCTCTGCTAACCAGG -3'
Posted On 2015-04-17