Mutagenetix > Incidental Mutations

Incidental Mutation 'R3919:Setdb2'

306911

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

040817-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.575) question?

Stock #

R3919 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59419167 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 250 (I250F)

Ref Sequence

ENSEMBL: ENSMUSP00000093450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]

Predicted Effect

probably damaging
Transcript: ENSMUST00000095775
AA Change: I250F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: I250F

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111253

Predicted Effect

probably damaging
Transcript: ENSMUST00000161459
AA Change: I234F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: I234F

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161959

Meta Mutation Damage Score

0.1562

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028J19Rik	G	T	7: 44,230,428		probably benign	Het
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
Abcb5	A	G	12: 118,890,618	M854T	possibly damaging	Het
Akap9	T	A	5: 3,961,764	Y822*	probably null	Het
Apoe	T	C	7: 19,696,547	T257A	probably benign	Het
Atm	C	A	9: 53,492,278	A1365S	probably benign	Het
Bmp2k	T	C	5: 97,074,740	S674P	unknown	Het
Cd177	T	C	7: 24,744,433	S747G	probably benign	Het
Cdk5rap2	A	G	4: 70,380,223	F91L	possibly damaging	Het
Chil4	A	T	3: 106,202,532	N388K	probably benign	Het
Dnah3	G	A	7: 119,951,080	L3328F	probably damaging	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Ercc5	C	A	1: 44,161,931	T217K	probably damaging	Het
Esyt1	T	A	10: 128,521,036		probably benign	Het
Ifih1	C	A	2: 62,623,501		probably benign	Het
Ints12	A	T	3: 133,100,683	T124S	probably benign	Het
Kdm5d	T	C	Y: 939,914	L1022P	probably damaging	Het
Lama2	T	A	10: 27,118,505	N1803Y	probably damaging	Het
Lpcat2	C	T	8: 92,914,274	T449I	probably damaging	Het
Ly6c2	A	T	15: 75,108,764		probably null	Het
Mast3	T	C	8: 70,779,422	K1304E	probably benign	Het
Mdm4	T	C	1: 132,994,568	K279E	possibly damaging	Het
Mest	G	A	6: 30,742,750	S132N	probably benign	Het
Mras	T	A	9: 99,411,420	I56F	probably damaging	Het
Mrgprb1	T	C	7: 48,448,081	K28E	probably benign	Het
Myrip	G	A	9: 120,432,629	G436D	probably damaging	Het
Nr2e3	T	A	9: 59,943,440	T379S	probably damaging	Het
Olfr1065	A	G	2: 86,445,418	V188A	probably benign	Het
Plscr3	T	A	11: 69,847,410		probably benign	Het
Pola1	C	A	X: 93,461,472	R1313L	probably benign	Het
Ppt2	T	C	17: 34,622,923	N213S	probably damaging	Het
Prelid2	T	A	18: 41,937,675	D31V	possibly damaging	Het
Psmb9	C	T	17: 34,183,614		probably null	Het
Rec8	A	G	14: 55,621,259	T164A	probably benign	Het
Rnf103	G	A	6: 71,510,347	R654Q	probably benign	Het
Slurp1	A	T	15: 74,726,810	*111K	probably null	Het
Sphkap	T	G	1: 83,276,458	E903A	probably damaging	Het
Sst	T	C	16: 23,889,841	D80G	possibly damaging	Het
Stat4	C	T	1: 52,096,822	T430I	possibly damaging	Het
Tmprss4	C	T	9: 45,180,666	V174M	probably benign	Het
Trim6	A	T	7: 104,232,850	Y436F	probably damaging	Het
Ttc28	C	A	5: 111,285,379	A2093E	possibly damaging	Het
Vav3	A	G	3: 109,527,538	N462D	possibly damaging	Het
Whrn	G	T	4: 63,495,184	S17*	probably null	Het
Zfhx4	T	A	3: 5,399,115	S1469R	possibly damaging	Het
Zfp108	T	A	7: 24,260,832	C283S	probably damaging	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGTCTATGCAGCCCTCAG -3'
(R):5'- AATCAGATGTCACTTCCAAAGACG -3'

Sequencing Primer
(F):5'- TGTCTATGCAGCCCTCAGAACAG -3'
(R):5'- CTGCCCTCCATGTGAATTATAAAACG -3'

Posted On

2015-04-17