Incidental Mutation 'R3919:Setdb2'
ID 306911
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene Name SET domain, bifurcated 2
Synonyms KMT1F, LOC239122
MMRRC Submission 040817-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.544) question?
Stock # R3919 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 59639458-59678329 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59656616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 250 (I250F)
Ref Sequence ENSEMBL: ENSMUSP00000093450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]
AlphaFold Q8C267
Predicted Effect probably damaging
Transcript: ENSMUST00000095775
AA Change: I250F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: I250F

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111253
Predicted Effect probably damaging
Transcript: ENSMUST00000161459
AA Change: I234F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: I234F

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161959
Meta Mutation Damage Score 0.1562 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 43,879,852 (GRCm39) probably benign Het
4930567H17Rik C T X: 69,438,135 (GRCm39) A53T probably benign Het
Abcb5 A G 12: 118,854,353 (GRCm39) M854T possibly damaging Het
Akap9 T A 5: 4,011,764 (GRCm39) Y822* probably null Het
Apoe T C 7: 19,430,472 (GRCm39) T257A probably benign Het
Atm C A 9: 53,403,578 (GRCm39) A1365S probably benign Het
Bmp2k T C 5: 97,222,599 (GRCm39) S674P unknown Het
Cd177 T C 7: 24,443,858 (GRCm39) S747G probably benign Het
Cdk5rap2 A G 4: 70,298,460 (GRCm39) F91L possibly damaging Het
Chil4 A T 3: 106,109,848 (GRCm39) N388K probably benign Het
Dnah3 G A 7: 119,550,303 (GRCm39) L3328F probably damaging Het
Dysf G A 6: 84,163,491 (GRCm39) probably null Het
Ercc5 C A 1: 44,201,091 (GRCm39) T217K probably damaging Het
Esyt1 T A 10: 128,356,905 (GRCm39) probably benign Het
Ifih1 C A 2: 62,453,845 (GRCm39) probably benign Het
Ints12 A T 3: 132,806,444 (GRCm39) T124S probably benign Het
Kdm5d T C Y: 939,914 (GRCm39) L1022P probably damaging Het
Lama2 T A 10: 26,994,501 (GRCm39) N1803Y probably damaging Het
Lpcat2 C T 8: 93,640,902 (GRCm39) T449I probably damaging Het
Ly6c2 A T 15: 74,980,613 (GRCm39) probably null Het
Mast3 T C 8: 71,232,066 (GRCm39) K1304E probably benign Het
Mdm4 T C 1: 132,922,306 (GRCm39) K279E possibly damaging Het
Mest G A 6: 30,742,749 (GRCm39) S132N probably benign Het
Mras T A 9: 99,293,473 (GRCm39) I56F probably damaging Het
Mrgprb1 T C 7: 48,097,829 (GRCm39) K28E probably benign Het
Myrip G A 9: 120,261,695 (GRCm39) G436D probably damaging Het
Nr2e3 T A 9: 59,850,723 (GRCm39) T379S probably damaging Het
Or8k27 A G 2: 86,275,762 (GRCm39) V188A probably benign Het
Plscr3 T A 11: 69,738,236 (GRCm39) probably benign Het
Pola1 C A X: 92,505,078 (GRCm39) R1313L probably benign Het
Ppt2 T C 17: 34,841,897 (GRCm39) N213S probably damaging Het
Prelid2 T A 18: 42,070,740 (GRCm39) D31V possibly damaging Het
Psmb9 C T 17: 34,402,588 (GRCm39) probably null Het
Rec8 A G 14: 55,858,716 (GRCm39) T164A probably benign Het
Rnf103 G A 6: 71,487,331 (GRCm39) R654Q probably benign Het
Slurp1 A T 15: 74,598,659 (GRCm39) *111K probably null Het
Sphkap T G 1: 83,254,179 (GRCm39) E903A probably damaging Het
Sst T C 16: 23,708,591 (GRCm39) D80G possibly damaging Het
Stat4 C T 1: 52,135,981 (GRCm39) T430I possibly damaging Het
Tmprss4 C T 9: 45,091,964 (GRCm39) V174M probably benign Het
Trim6 A T 7: 103,882,057 (GRCm39) Y436F probably damaging Het
Ttc28 C A 5: 111,433,245 (GRCm39) A2093E possibly damaging Het
Vav3 A G 3: 109,434,854 (GRCm39) N462D possibly damaging Het
Whrn G T 4: 63,413,421 (GRCm39) S17* probably null Het
Zfhx4 T A 3: 5,464,175 (GRCm39) S1469R possibly damaging Het
Zfp108 T A 7: 23,960,257 (GRCm39) C283S probably damaging Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59,653,241 (GRCm39) missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59,639,742 (GRCm39) utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59,660,885 (GRCm39) missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59,650,939 (GRCm39) missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59,668,607 (GRCm39) missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59,644,193 (GRCm39) splice site probably null
R0610:Setdb2 UTSW 14 59,654,919 (GRCm39) missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59,644,153 (GRCm39) missense probably benign 0.40
R0890:Setdb2 UTSW 14 59,656,669 (GRCm39) missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59,660,945 (GRCm39) splice site probably benign
R1355:Setdb2 UTSW 14 59,654,890 (GRCm39) missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59,654,934 (GRCm39) missense probably benign 0.04
R1968:Setdb2 UTSW 14 59,656,858 (GRCm39) missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59,656,903 (GRCm39) missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59,663,916 (GRCm39) missense probably benign 0.00
R4609:Setdb2 UTSW 14 59,653,153 (GRCm39) missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59,646,808 (GRCm39) missense probably benign 0.13
R4816:Setdb2 UTSW 14 59,651,095 (GRCm39) missense probably benign 0.05
R4864:Setdb2 UTSW 14 59,646,715 (GRCm39) missense probably benign 0.01
R4951:Setdb2 UTSW 14 59,639,752 (GRCm39) missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59,653,156 (GRCm39) missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59,663,943 (GRCm39) missense probably null 0.00
R5358:Setdb2 UTSW 14 59,646,885 (GRCm39) missense probably benign 0.17
R5656:Setdb2 UTSW 14 59,656,567 (GRCm39) missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59,660,814 (GRCm39) missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59,646,981 (GRCm39) splice site probably null
R6106:Setdb2 UTSW 14 59,660,898 (GRCm39) nonsense probably null
R6388:Setdb2 UTSW 14 59,662,146 (GRCm39) missense probably benign
R6431:Setdb2 UTSW 14 59,656,505 (GRCm39) missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59,639,863 (GRCm39) missense probably benign 0.12
R6971:Setdb2 UTSW 14 59,653,189 (GRCm39) missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59,656,700 (GRCm39) missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59,660,794 (GRCm39) nonsense probably null
R7759:Setdb2 UTSW 14 59,656,813 (GRCm39) missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59,660,833 (GRCm39) nonsense probably null
R8039:Setdb2 UTSW 14 59,639,824 (GRCm39) missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59,651,141 (GRCm39) splice site probably benign
R8393:Setdb2 UTSW 14 59,650,180 (GRCm39) missense probably benign 0.04
R8513:Setdb2 UTSW 14 59,639,839 (GRCm39) missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59,654,888 (GRCm39) missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59,660,907 (GRCm39) nonsense probably null
R8940:Setdb2 UTSW 14 59,646,956 (GRCm39) missense probably damaging 1.00
R9217:Setdb2 UTSW 14 59,646,881 (GRCm39) missense possibly damaging 0.61
R9314:Setdb2 UTSW 14 59,650,240 (GRCm39) missense probably benign 0.02
R9336:Setdb2 UTSW 14 59,660,816 (GRCm39) missense unknown
R9442:Setdb2 UTSW 14 59,639,849 (GRCm39) missense probably damaging 1.00
R9525:Setdb2 UTSW 14 59,646,841 (GRCm39) missense probably benign 0.00
R9743:Setdb2 UTSW 14 59,651,002 (GRCm39) missense probably benign 0.00
X0017:Setdb2 UTSW 14 59,656,917 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTCTATGCAGCCCTCAG -3'
(R):5'- AATCAGATGTCACTTCCAAAGACG -3'

Sequencing Primer
(F):5'- TGTCTATGCAGCCCTCAGAACAG -3'
(R):5'- CTGCCCTCCATGTGAATTATAAAACG -3'
Posted On 2015-04-17