Incidental Mutation 'R3919:Slurp1'
ID 306912
Institutional Source Beutler Lab
Gene Symbol Slurp1
Ensembl Gene ENSMUSG00000022596
Gene Name secreted Ly6/Plaur domain containing 1
Synonyms ARS component B, 1110021N19Rik
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3919 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 74724318-74728034 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) A to T at 74726810 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Lysine at position 111 (*111K)
Ref Sequence ENSEMBL: ENSMUSP00000141013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023261] [ENSMUST00000070923] [ENSMUST00000190433]
AlphaFold Q9Z0K7
Predicted Effect probably benign
Transcript: ENSMUST00000023261
SMART Domains Protein: ENSMUSP00000023261
Gene: ENSMUSG00000022596

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LU 23 109 6.93e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070923
SMART Domains Protein: ENSMUSP00000069692
Gene: ENSMUSG00000056665

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Pfam:4HBT_2 54 185 5.8e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190433
AA Change: *111K
SMART Domains Protein: ENSMUSP00000141013
Gene: ENSMUSG00000022596
AA Change: *111K

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
LU 23 109 6.93e-2 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ly6/uPAR family but lacks a GPI-anchoring signal sequence. It is thought that this secreted protein contains antitumor activity. Mutations in this gene have been associated with Mal de Meleda, a rare autosomal recessive skin disorder. This gene maps to the same chromosomal region as several members of the Ly6/uPAR family of glycoprotein receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop palmoplantar keratoderma, decreased body weight, and neuromuscular and metabolic phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Slurp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0759:Slurp1 UTSW 15 74726959 missense probably damaging 0.97
R4031:Slurp1 UTSW 15 74727487 missense probably damaging 1.00
R4090:Slurp1 UTSW 15 74726875 missense possibly damaging 0.47
R8939:Slurp1 UTSW 15 74726914 missense probably damaging 0.99
R9116:Slurp1 UTSW 15 74727601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGCACTTCAGGTTCCCAG -3'
(R):5'- AGGAACTGCAGTGACTTGG -3'

Sequencing Primer
(F):5'- AGAACAGAGAGGCCCCTTCG -3'
(R):5'- AACTGCAGTGACTTGGGGCTC -3'
Posted On 2015-04-17