Incidental Mutation 'R3919:Sst'
ID 306914
Institutional Source Beutler Lab
Gene Symbol Sst
Ensembl Gene ENSMUSG00000004366
Gene Name somatostatin
Synonyms preprosomatostatin, Smst, SOM, SRIF
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3919 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 23889573-23890958 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23889841 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 80 (D80G)
Ref Sequence ENSEMBL: ENSMUSP00000004480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004480]
AlphaFold P60041
Predicted Effect possibly damaging
Transcript: ENSMUST00000004480
AA Change: D80G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004480
Gene: ENSMUSG00000004366
AA Change: D80G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Somatostatin 99 116 5.9e-15 PFAM
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered GH secretory dynamics, hypergastremia, and reduced hippocampal bursting and excitatory transmission. Mice homozygous for another null allele show impaired motor learning, higher GH and corticosterone levels,gastric fundus hyperplasia and hyperacidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Sst
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1472:Sst UTSW 16 23890698 missense probably benign
R1853:Sst UTSW 16 23890653 missense probably damaging 1.00
R2209:Sst UTSW 16 23889808 missense probably benign 0.05
R4350:Sst UTSW 16 23889815 missense probably damaging 0.99
R4351:Sst UTSW 16 23889815 missense probably damaging 0.99
R4352:Sst UTSW 16 23889815 missense probably damaging 0.99
R5586:Sst UTSW 16 23889737 missense probably damaging 1.00
R6844:Sst UTSW 16 23889842 missense probably benign 0.00
R7492:Sst UTSW 16 23889826 missense probably damaging 1.00
R8903:Sst UTSW 16 23889749 nonsense probably null
R9417:Sst UTSW 16 23889737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCAAGTTGAGCATCGG -3'
(R):5'- ACCCATATGATTGTGAAAACTGGG -3'

Sequencing Primer
(F):5'- AAGTTGAGCATCGGGGGCC -3'
(R):5'- CATATGATTGTGAAAACTGGGTTTTG -3'
Posted On 2015-04-17