Incidental Mutation 'R3919:Psmb9'
ID 306915
Institutional Source Beutler Lab
Gene Symbol Psmb9
Ensembl Gene ENSMUSG00000096727
Gene Name proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2)
Synonyms Lmp2, Lmp-2
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R3919 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34181988-34187764 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 34183614 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041633] [ENSMUST00000170086] [ENSMUST00000171321] [ENSMUST00000171321] [ENSMUST00000171321] [ENSMUST00000171321] [ENSMUST00000173831] [ENSMUST00000174576]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041633
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166853
Predicted Effect probably benign
Transcript: ENSMUST00000170086
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171321
Predicted Effect probably null
Transcript: ENSMUST00000171321
Predicted Effect probably null
Transcript: ENSMUST00000171321
Predicted Effect probably null
Transcript: ENSMUST00000171321
Predicted Effect probably benign
Transcript: ENSMUST00000173831
SMART Domains Protein: ENSMUSP00000134120
Gene: ENSMUSG00000096727

DomainStartEndE-ValueType
Pfam:Proteasome 1 64 2.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174576
SMART Domains Protein: ENSMUSP00000133499
Gene: ENSMUSG00000096727

DomainStartEndE-ValueType
Pfam:Proteasome 17 198 1.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179593
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 1 (proteasome beta 6 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a grossly normal phenotype but suffer from increased susceptibility to some viruses and have an increased risk of tumor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Psmb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Psmb9 APN 17 34183679 missense probably damaging 1.00
bias UTSW 17 34183225 nonsense probably null
preconception UTSW 17 34183614 critical splice donor site probably null
R0021:Psmb9 UTSW 17 34184303 missense probably benign 0.26
R0105:Psmb9 UTSW 17 34187275 missense probably benign
R0477:Psmb9 UTSW 17 34182264 missense probably damaging 0.99
R5898:Psmb9 UTSW 17 34182292 missense probably damaging 0.97
R5943:Psmb9 UTSW 17 34184291 missense probably damaging 0.99
R6408:Psmb9 UTSW 17 34185733 missense probably damaging 1.00
R6919:Psmb9 UTSW 17 34183225 nonsense probably null
R8512:Psmb9 UTSW 17 34183628 missense probably benign
R9105:Psmb9 UTSW 17 34182931 intron probably benign
R9304:Psmb9 UTSW 17 34187248 critical splice donor site probably null
R9454:Psmb9 UTSW 17 34183104 missense probably benign 0.00
R9633:Psmb9 UTSW 17 34183145 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACTTGAGCCTACAGTATGC -3'
(R):5'- AGAGTGCTGTTGACCCTCCTTC -3'

Sequencing Primer
(F):5'- ACAGGGTTTCACTAATGTAGCCC -3'
(R):5'- TCCCGACATCCGCTTCAGG -3'
Posted On 2015-04-17