Incidental Mutation 'R3919:Ppt2'
ID306916
Institutional Source Beutler Lab
Gene Symbol Ppt2
Ensembl Gene ENSMUSG00000015474
Gene Namepalmitoyl-protein thioesterase 2
Synonyms
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3919 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34616662-34628510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34622923 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 213 (N213S)
Ref Sequence ENSEMBL: ENSMUSP00000131243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064953] [ENSMUST00000166040] [ENSMUST00000167097] [ENSMUST00000168391] [ENSMUST00000169067] [ENSMUST00000169287] [ENSMUST00000170345] [ENSMUST00000171121] [ENSMUST00000171376]
Predicted Effect probably damaging
Transcript: ENSMUST00000064953
AA Change: N213S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068071
Gene: ENSMUSG00000015474
AA Change: N213S

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166040
AA Change: N213S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132006
Gene: ENSMUSG00000015474
AA Change: N213S

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 289 9e-19 PFAM
Pfam:Abhydrolase_1 37 173 9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167097
AA Change: N213S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125937
Gene: ENSMUSG00000015474
AA Change: N213S

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 236 7.7e-12 PFAM
Pfam:Abhydrolase_6 39 236 2.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168391
AA Change: N213S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132339
Gene: ENSMUSG00000015474
AA Change: N213S

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168709
Predicted Effect probably damaging
Transcript: ENSMUST00000169067
AA Change: N213S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127372
Gene: ENSMUSG00000015474
AA Change: N213S

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169287
SMART Domains Protein: ENSMUSP00000129421
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
PDB:1PJA|A 1 102 2e-42 PDB
SCOP:d1fj2a_ 29 91 7e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000169969
AA Change: N157S
SMART Domains Protein: ENSMUSP00000127726
Gene: ENSMUSG00000015474
AA Change: N157S

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:Abhydrolase_1 18 139 9e-8 PFAM
Pfam:Palm_thioest 116 234 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170345
SMART Domains Protein: ENSMUSP00000127707
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 33 203 1.6e-9 PFAM
Pfam:Abhydrolase_6 39 201 2.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171121
AA Change: N213S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127745
Gene: ENSMUSG00000015474
AA Change: N213S

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171376
AA Change: N213S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131243
Gene: ENSMUSG00000015474
AA Change: N213S

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Meta Mutation Damage Score 0.3380 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the palmitoyl-protein thioesterase family. The encoded glycosylated lysosomal protein has palmitoyl-CoA hydrolase activity in vitro, but does not hydrolyze palmitate from cysteine residues in proteins. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream EGFL8 (EGF-like-domain, multiple 8) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants show autofluorescent storage material in brain, abnormal clasping behavior, spasticity, ataxia and increased adult mortality. In addition, lipofuscin pigments in pancreas, bone marrow histiocytosis and splenomegaly are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Ppt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Ppt2 APN 17 34625754 splice site probably benign
R0180:Ppt2 UTSW 17 34626503 missense probably damaging 1.00
R0685:Ppt2 UTSW 17 34626572 missense probably damaging 0.98
R1498:Ppt2 UTSW 17 34623101 missense probably benign 0.00
R2058:Ppt2 UTSW 17 34622844 splice site probably benign
R2059:Ppt2 UTSW 17 34622844 splice site probably benign
R4622:Ppt2 UTSW 17 34625901 missense probably benign 0.16
R5582:Ppt2 UTSW 17 34617399 missense probably damaging 0.99
R5638:Ppt2 UTSW 17 34625849 missense probably benign 0.37
R6502:Ppt2 UTSW 17 34625920 missense probably damaging 1.00
R7065:Ppt2 UTSW 17 34622855 missense probably damaging 1.00
R7523:Ppt2 UTSW 17 34626803 critical splice donor site probably null
R7587:Ppt2 UTSW 17 34626803 critical splice donor site probably null
R7782:Ppt2 UTSW 17 34625712 missense probably benign 0.05
R7910:Ppt2 UTSW 17 34627326 splice site probably null
R7991:Ppt2 UTSW 17 34627326 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCAAGCCAGAGTTATGCACTG -3'
(R):5'- CACCACGATGACTTGTACCTCAATG -3'

Sequencing Primer
(F):5'- GGGACCCTGTCTGTCTCTAAAAG -3'
(R):5'- GATGACTTGTACCTCAATGCCAGC -3'
Posted On2015-04-17