Incidental Mutation 'R3919:Pola1'
ID 306919
Institutional Source Beutler Lab
Gene Symbol Pola1
Ensembl Gene ENSMUSG00000006678
Gene Name polymerase (DNA directed), alpha 1
Synonyms Pola
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R3919 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 93304767-93632155 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 93461472 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1313 (R1313L)
Ref Sequence ENSEMBL: ENSMUSP00000006856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006856]
AlphaFold P33609
Predicted Effect probably benign
Transcript: ENSMUST00000006856
AA Change: R1313L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000006856
Gene: ENSMUSG00000006678
AA Change: R1313L

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
Pfam:DNA_pol_alpha_N 41 102 5.5e-22 PFAM
Blast:POLBc 136 508 1e-152 BLAST
POLBc 539 1016 2.07e-134 SMART
low complexity region 1051 1058 N/A INTRINSIC
Blast:POLBc 1098 1187 4e-47 BLAST
Pfam:zf-DNA_Pol 1269 1458 4.5e-52 PFAM
Meta Mutation Damage Score 0.3485 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase, which together with a regulatory and two primase subunits, forms the DNA polymerase alpha complex. The catalytic subunit plays an essential role in the initiation of DNA replication. [provided by RefSeq, Mar 2010]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele appear normal at E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Nr2e3 T A 9: 59,943,440 T379S probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Pola1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Pola1 APN X 93594785 missense possibly damaging 0.62
IGL00469:Pola1 APN X 93561385 missense probably damaging 1.00
IGL00946:Pola1 APN X 93480539 missense probably benign 0.01
R0606:Pola1 UTSW X 93488087 splice site probably benign
R1955:Pola1 UTSW X 93597261 missense probably damaging 1.00
R3918:Pola1 UTSW X 93461472 missense probably benign 0.01
R4402:Pola1 UTSW X 93561423 missense probably damaging 0.99
Z1176:Pola1 UTSW X 93480604 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAATTTCCTAAGTGTTCTCAACTGC -3'
(R):5'- AGATACCACGTACTTCTAATTAGGG -3'

Sequencing Primer
(F):5'- AAGTGTTCTCAACTGCAATAAAAAC -3'
(R):5'- CGTACTTCTAATTAGGGTCTTAAAGC -3'
Posted On 2015-04-17