Incidental Mutation 'R3934:Slc39a12'
ID306924
Institutional Source Beutler Lab
Gene Symbol Slc39a12
Ensembl Gene ENSMUSG00000036949
Gene Namesolute carrier family 39 (zinc transporter), member 12
SynonymsLOC277468
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3934 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location14388316-14494977 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 14434363 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082290] [ENSMUST00000114731]
Predicted Effect probably benign
Transcript: ENSMUST00000082290
SMART Domains Protein: ENSMUSP00000080911
Gene: ENSMUSG00000036949

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zip 364 681 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114731
SMART Domains Protein: ENSMUSP00000110379
Gene: ENSMUSG00000036949

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Zip 382 511 2.5e-17 PFAM
Pfam:Zip 492 661 1.5e-41 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A12 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,534,081 Y381N possibly damaging Het
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Aig1 T C 10: 13,801,912 D112G probably damaging Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fastk G T 5: 24,442,259 S317* probably null Het
Fgfr1op2 T A 6: 146,595,171 probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Hspbp1 A T 7: 4,664,595 M271K probably benign Het
Itgb6 G A 2: 60,611,411 T685M possibly damaging Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Perm1 A G 4: 156,219,170 T724A probably benign Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Prpf38b T C 3: 108,904,425 probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Sod3 T C 5: 52,368,645 S229P probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Wdr35 G T 12: 9,008,014 G513C probably damaging Het
Other mutations in Slc39a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Slc39a12 APN 2 14396068 splice site probably benign
IGL01597:Slc39a12 APN 2 14434309 missense possibly damaging 0.95
IGL02516:Slc39a12 APN 2 14400335 missense probably damaging 1.00
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0453:Slc39a12 UTSW 2 14435681 missense probably benign 0.04
R0533:Slc39a12 UTSW 2 14400331 missense probably benign 0.00
R0718:Slc39a12 UTSW 2 14407426 splice site probably benign
R1647:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1648:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1879:Slc39a12 UTSW 2 14444057 missense probably benign
R1993:Slc39a12 UTSW 2 14434219 missense probably damaging 0.98
R2429:Slc39a12 UTSW 2 14405086 missense probably benign 0.06
R3746:Slc39a12 UTSW 2 14396067 splice site probably benign
R3941:Slc39a12 UTSW 2 14396181 missense possibly damaging 0.95
R4008:Slc39a12 UTSW 2 14452117 missense probably damaging 1.00
R4478:Slc39a12 UTSW 2 14420179 nonsense probably null
R4622:Slc39a12 UTSW 2 14400325 missense probably benign 0.11
R4760:Slc39a12 UTSW 2 14400323 missense probably benign 0.14
R5477:Slc39a12 UTSW 2 14389382 missense possibly damaging 0.46
R5566:Slc39a12 UTSW 2 14407603 missense possibly damaging 0.80
R5725:Slc39a12 UTSW 2 14389264 start gained probably benign
R5798:Slc39a12 UTSW 2 14449826 missense probably damaging 1.00
R6074:Slc39a12 UTSW 2 14407479 nonsense probably null
R6169:Slc39a12 UTSW 2 14400233 missense possibly damaging 0.64
R6180:Slc39a12 UTSW 2 14396127 missense probably benign 0.38
R6802:Slc39a12 UTSW 2 14420085 missense probably benign 0.28
R6847:Slc39a12 UTSW 2 14449917 missense probably damaging 1.00
R6899:Slc39a12 UTSW 2 14389541 missense probably damaging 1.00
R6931:Slc39a12 UTSW 2 14389375 missense probably benign 0.04
R7131:Slc39a12 UTSW 2 14449803 missense probably damaging 1.00
R7343:Slc39a12 UTSW 2 14452000 missense probably damaging 1.00
R7525:Slc39a12 UTSW 2 14494461 missense probably benign 0.01
R7568:Slc39a12 UTSW 2 14400128 splice site probably null
R7684:Slc39a12 UTSW 2 14449859 missense probably damaging 0.99
R7761:Slc39a12 UTSW 2 14434330 missense probably benign 0.01
R7785:Slc39a12 UTSW 2 14420218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTCCTGGCCTGAGTCTT -3'
(R):5'- TCAAAATAATCGCCGGTCCTT -3'

Sequencing Primer
(F):5'- CCTGGCCTGAGTCTTTTTGTTTG -3'
(R):5'- GGATGACCTTGAACTGATCCC -3'
Posted On2015-04-17