Incidental Mutation 'R3934:Itgb6'
ID306926
Institutional Source Beutler Lab
Gene Symbol Itgb6
Ensembl Gene ENSMUSG00000026971
Gene Nameintegrin beta 6
Synonyms4831415H04Rik, 2210409C20Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R3934 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location60598292-60722643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60611411 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 685 (T685M)
Ref Sequence ENSEMBL: ENSMUSP00000117815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028348] [ENSMUST00000059888] [ENSMUST00000112517] [ENSMUST00000154764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028348
AA Change: T685M

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028348
Gene: ENSMUSG00000026971
AA Change: T685M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000059888
AA Change: T685M

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054944
Gene: ENSMUSG00000026971
AA Change: T685M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112517
AA Change: T685M

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108136
Gene: ENSMUSG00000026971
AA Change: T685M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.81e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 759 2.38e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154764
AA Change: T685M

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117815
Gene: ENSMUSG00000026971
AA Change: T685M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.62e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 755 2.3e0 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms a dimer with an alpha v chain and this heterodimer can bind to ligands like fibronectin and transforming growth factor beta 1. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit baldness associated with macrophage infiltration of skin, exaggerated pulmonary inflammation, and an impaired mucosal mast cell response to nematode infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,534,081 Y381N possibly damaging Het
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Aig1 T C 10: 13,801,912 D112G probably damaging Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fastk G T 5: 24,442,259 S317* probably null Het
Fgfr1op2 T A 6: 146,595,171 probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Hspbp1 A T 7: 4,664,595 M271K probably benign Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Perm1 A G 4: 156,219,170 T724A probably benign Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Prpf38b T C 3: 108,904,425 probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc39a12 T A 2: 14,434,363 probably benign Het
Sod3 T C 5: 52,368,645 S229P probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Wdr35 G T 12: 9,008,014 G513C probably damaging Het
Other mutations in Itgb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Itgb6 APN 2 60620352 missense probably benign 0.07
IGL01363:Itgb6 APN 2 60611382 missense possibly damaging 0.89
IGL01810:Itgb6 APN 2 60627985 missense probably benign 0.19
IGL02026:Itgb6 APN 2 60628066 missense possibly damaging 0.79
IGL02347:Itgb6 APN 2 60611412 missense probably benign
R0372:Itgb6 UTSW 2 60627841 missense probably benign 0.28
R0533:Itgb6 UTSW 2 60669197 missense probably benign 0.22
R0542:Itgb6 UTSW 2 60605136 missense possibly damaging 0.53
R1037:Itgb6 UTSW 2 60650068 missense probably damaging 1.00
R1191:Itgb6 UTSW 2 60653137 splice site probably null
R1775:Itgb6 UTSW 2 60672644 nonsense probably null
R1802:Itgb6 UTSW 2 60653281 missense probably benign 0.22
R1934:Itgb6 UTSW 2 60669149 missense probably benign 0.05
R2847:Itgb6 UTSW 2 60600535 missense probably damaging 1.00
R5603:Itgb6 UTSW 2 60620362 missense probably benign 0.03
R6255:Itgb6 UTSW 2 60605276 missense probably damaging 1.00
R6571:Itgb6 UTSW 2 60628456 missense probably damaging 1.00
R6908:Itgb6 UTSW 2 60650021 missense probably benign 0.02
R7010:Itgb6 UTSW 2 60649978 missense probably damaging 1.00
R7212:Itgb6 UTSW 2 60634654 missense probably damaging 0.99
R7259:Itgb6 UTSW 2 60650011 missense probably damaging 1.00
R7300:Itgb6 UTSW 2 60605306 missense probably benign 0.04
R7491:Itgb6 UTSW 2 60620376 missense probably damaging 1.00
R7532:Itgb6 UTSW 2 60669213 missense probably benign
X0018:Itgb6 UTSW 2 60672666 missense possibly damaging 0.88
Z1088:Itgb6 UTSW 2 60620211 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGGAACACAGCAACAGCTTTAATG -3'
(R):5'- TTCCCATTCGACAGAATTGCC -3'

Sequencing Primer
(F):5'- CAGCAACAGCTTTAATGGGATC -3'
(R):5'- TCCCATTCGACAGAATTGCCAATTC -3'
Posted On2015-04-17